ID: 1051327099

View in Genome Browser
Species Human (GRCh38)
Location 9:15983949-15983971
Sequence CAATGGTTCTGGTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051327099_1051327108 25 Left 1051327099 9:15983949-15983971 CCATCTTCCCACCAGAACCATTG 0: 1
1: 0
2: 2
3: 30
4: 232
Right 1051327108 9:15983997-15984019 TCCTCTGCAGAGTAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051327099 Original CRISPR CAATGGTTCTGGTGGGAAGA TGG (reversed) Intronic
900462619 1:2808837-2808859 CCCTGGTGCTGGTGGGAAGGGGG + Intergenic
902245448 1:15117728-15117750 CATGGGCTCTGATGGGAAGAGGG - Exonic
904602733 1:31682866-31682888 GGATGTTTCTGCTGGGAAGAGGG - Intronic
905674902 1:39818331-39818353 CGGGGGTTCTGCTGGGAAGAAGG + Intergenic
905881292 1:41466058-41466080 AAATGGTGCGGATGGGAAGATGG - Intergenic
911692576 1:100850955-100850977 CTATGGTGCAGGTGGGAACAGGG + Intergenic
912567678 1:110599909-110599931 CCAGGTTTCTGGTGGGAGGAAGG + Intronic
913042405 1:115040218-115040240 GAATGAGGCTGGTGGGAAGATGG - Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
914958653 1:152187181-152187203 CAAGGGACCTGGTGGGAAGGGGG + Intergenic
915758370 1:158285946-158285968 CAAGGTTTCTGCTGGGAGGAAGG + Intergenic
917151534 1:171950678-171950700 AAATGGTTCTGTGAGGAAGAAGG + Intronic
918725033 1:187910167-187910189 TGATGGTCCTGATGGGAAGAAGG + Intergenic
919602610 1:199641053-199641075 CCATGGTTCTGGATGGAGGAGGG + Intergenic
921726167 1:218526004-218526026 CAAAGGTTCTGTTGGTAAGTAGG - Intergenic
921803002 1:219422969-219422991 CATGGGTTCTTGTGGGAAGGAGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
1062923515 10:1297604-1297626 CAAGGGAGCTGCTGGGAAGAGGG - Intronic
1063202848 10:3801598-3801620 CAAGGGCTCTGGGGGAAAGATGG + Intergenic
1064032227 10:11890150-11890172 AAATGATTCTGGTGGGGGGATGG + Intergenic
1064715230 10:18170062-18170084 CATTGGCTCTGGTTGGATGATGG + Intronic
1065751122 10:28888301-28888323 CAATGGTTCACATAGGAAGAAGG - Intergenic
1067561601 10:47308508-47308530 CTTTGTTTCTGTTGGGAAGAAGG - Intronic
1067689876 10:48494855-48494877 CAAAGTTTCTGGTGGGAAGAGGG - Intronic
1068690754 10:59911411-59911433 TAATGATTCTTGTTGGAAGAAGG + Intergenic
1070290405 10:75110135-75110157 CAATGGTCCTGTAGTGAAGATGG + Intronic
1070994440 10:80763675-80763697 CAATGGTTCAGGTTGGATGAGGG + Intergenic
1071107535 10:82115824-82115846 AAATGCCTCTGGTGGGCAGATGG + Intronic
1071503805 10:86221307-86221329 GAAATGTGCTGGTGGGAAGATGG - Intronic
1072283407 10:93891196-93891218 CCATAGTTCTGGTGTCAAGAAGG - Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1076435110 10:130435224-130435246 CAGAGCTTCTGGTGGGAACATGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077256377 11:1585246-1585268 CCATGGTTCTGGTGGATTGAGGG + Exonic
1077258118 11:1598247-1598269 CCATGGTTCTGGTGGATTGAGGG + Exonic
1077259527 11:1608382-1608404 CCATGGTTCTGGTGGGTTGAGGG + Exonic
1077261253 11:1622090-1622112 CCATGGTTCTGGTGGATTGAGGG + Exonic
1077262397 11:1629822-1629844 CCATGGTTCTGGTGGATTGAGGG - Exonic
1077274432 11:1697227-1697249 CCATGGTTCTGGTGGATTGAGGG - Exonic
1079024992 11:16940032-16940054 CACTGGTGCTGGGGGCAAGAAGG + Intronic
1081808289 11:45901676-45901698 CAATGTGTGTGGTGGCAAGAGGG - Intronic
1083159173 11:60844079-60844101 GGCTGGTTCAGGTGGGAAGAGGG + Intronic
1084798745 11:71527282-71527304 CCATGGTTCTGGTGGATTGAGGG - Exonic
1084800083 11:71538037-71538059 CCATGGTTCTGGTGGGTTGAGGG - Exonic
1084801751 11:71548639-71548661 CCATGGTTCTGGTGGATTGAGGG - Exonic
1085487312 11:76876243-76876265 CAGTGGTTGTGCTGGAAAGAAGG - Intronic
1086020742 11:82226677-82226699 AAATGGTTGTGATGGCAAGAGGG + Intergenic
1086417892 11:86607368-86607390 CAATGAGTATGGTGGGAAAAGGG - Intronic
1087692871 11:101342145-101342167 CAATTCTTCAGGTGAGAAGAGGG + Intergenic
1088349037 11:108864289-108864311 CAATGATTCTGATGGGAGAAGGG - Intronic
1090206405 11:124886849-124886871 CAATGGTTTGGGTGGAATGAGGG + Intronic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1097068524 12:56338200-56338222 GAAAGGCTCTTGTGGGAAGAGGG - Intronic
1097409639 12:59235476-59235498 CCATGGTTCTGTGGGAAAGAAGG + Intergenic
1099953894 12:89333755-89333777 GATTTGTTTTGGTGGGAAGAAGG - Intergenic
1100939839 12:99714251-99714273 CAAGGGTTCTTATGAGAAGAAGG - Intronic
1101724194 12:107375759-107375781 CAATTGTCCAGCTGGGAAGAGGG - Intronic
1104210195 12:126681583-126681605 AAATAATGCTGGTGGGAAGAGGG - Intergenic
1106752417 13:32788638-32788660 CAATGATGATGGTGGGTAGAAGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1111808720 13:93070536-93070558 CAATTGTTTTGAAGGGAAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113569317 13:111342741-111342763 GAATGACTCTGATGGGAAGAGGG - Exonic
1120035447 14:79691724-79691746 CTATGTTTCTGATGGGAATACGG + Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1122111459 14:99506073-99506095 CCATGGTTTTGGTGGCAAGATGG + Exonic
1124358541 15:29017168-29017190 GAAGGGCTGTGGTGGGAAGAGGG + Intronic
1124389790 15:29244082-29244104 CAATGGTCCTGGTGCTGAGAAGG - Intronic
1124979778 15:34559290-34559312 CAGAGGTTCTGTTGTGAAGATGG + Intronic
1125714498 15:41811678-41811700 GAATGGTTCTGATGGGCAGCCGG - Intronic
1126378835 15:48025046-48025068 TACTGGTAGTGGTGGGAAGAGGG - Intergenic
1128546734 15:68573489-68573511 GAAGGGTTGTGGTGGGTAGAGGG + Intergenic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129244089 15:74269313-74269335 CCACGGTGCTGGTGGGAAGTAGG - Intronic
1129884213 15:79027262-79027284 CAGTGGTTCTCATGGGTAGAAGG - Intronic
1132354405 15:101160485-101160507 CAATAGTTCTGGTGGGACTGTGG - Intergenic
1134778536 16:16874061-16874083 GAATGGCTGAGGTGGGAAGATGG - Intergenic
1135414237 16:22256919-22256941 CAAGGGCTGTGGTGGGCAGAGGG - Intronic
1136571273 16:31098448-31098470 CAATGTTTCTGGTTTGAAGATGG + Intergenic
1136581452 16:31153683-31153705 CAATGGATCTTATGGGAGGAAGG + Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1137810215 16:51345431-51345453 GAATTCTGCTGGTGGGAAGACGG + Intergenic
1138554006 16:57761831-57761853 GGATGGTTCTGGGGGGAGGAGGG - Intronic
1138786454 16:59852181-59852203 CTATGGTTCTGCTGGGGGGAAGG - Intergenic
1140128527 16:72137570-72137592 CAACGCTTGTGGTGGGAACATGG + Intronic
1141386802 16:83628772-83628794 CAAGGTTTCAGGTGGGAAAAAGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142851763 17:2707872-2707894 CACTGGTTCTGGTGGAAGGGAGG + Intronic
1143563425 17:7708246-7708268 CATTGGTACTGCTGGGCAGAGGG + Exonic
1144041724 17:11417675-11417697 CAATGGCTCTGCTGAGAAGATGG - Intronic
1144647198 17:16983184-16983206 CAATGGTTCTGGCAGGCAGCTGG - Intergenic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1147745940 17:42694658-42694680 CCATGGTGATGGTGGGAAGATGG - Intronic
1147909157 17:43844487-43844509 CCATGCTTCTGGTGGGAAGCAGG + Intergenic
1148910299 17:50938961-50938983 CTATTTTTCTGGTGGGAAGCAGG - Intergenic
1150189587 17:63224160-63224182 CAATGTTTCTAGTGGCAAGATGG - Intronic
1150227904 17:63533758-63533780 CCACGGCTCTGGTGGGCAGAGGG - Intronic
1151400477 17:73852700-73852722 CGATGGTGGTGGTGGGTAGAGGG - Intergenic
1153542905 18:6175230-6175252 CACTGTTTCTGGTGAGAAGGTGG - Intronic
1155064908 18:22260253-22260275 TAATGTCTCTAGTGGGAAGAGGG + Intergenic
1156455756 18:37293010-37293032 CAGTGGTTCAGGTGGATAGAAGG + Intronic
1157044727 18:44087540-44087562 TAATGATTATGGTGGGCAGAAGG - Intergenic
1157640191 18:49204856-49204878 CAATGCTTCTGGGGGTAAAATGG + Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159122519 18:64187295-64187317 CCATGGCTCTGGAGGGACGAGGG - Intergenic
1159566190 18:70053294-70053316 CATTGATTCTGGGGAGAAGAGGG - Intronic
1160096682 18:75879554-75879576 CAATGGTTCTGTTGAGTAGCTGG - Intergenic
1162164334 19:8742354-8742376 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162165406 19:8749822-8749844 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162166471 19:8757278-8757300 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162167537 19:8764734-8764756 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162168476 19:8771032-8771054 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162169546 19:8778482-8778504 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162170226 19:8783796-8783818 CAAAGGTTCAGGTGAGAGGACGG + Intergenic
1162563716 19:11433412-11433434 CAGTGGTTCTTGTTGGAAAAGGG - Intronic
1163171502 19:15534725-15534747 CAATGGTTCAGCTGAGAAGGGGG + Intronic
1167946363 19:52992312-52992334 GAGTGGTGCTGGTGGCAAGAGGG - Intergenic
1168317771 19:55491518-55491540 CAAGGGAGCTGGTGGGAAGGAGG + Intronic
925060153 2:884761-884783 CAGTGGTGGTGCTGGGAAGATGG + Intergenic
925345461 2:3168937-3168959 CAATGCTGCTGTTGGGAATAAGG - Intergenic
926546195 2:14243239-14243261 TAATGGTTCTGATGGGAAAATGG - Intergenic
926583356 2:14656573-14656595 TAATGGATATGGTTGGAAGAGGG + Intergenic
927941097 2:27103260-27103282 CAATGGGTATGCTGGGTAGAAGG - Intronic
928656627 2:33458715-33458737 CAATGGTGCTGGTGGAAAAAGGG - Intronic
929312104 2:40437285-40437307 CATTTATTCAGGTGGGAAGAAGG - Intronic
929937270 2:46302545-46302567 GCATGGTACTGGTGGGGAGAGGG - Intronic
930019587 2:46993435-46993457 CGATGTTCCTGGTGGGAGGACGG - Exonic
932846786 2:75143442-75143464 CAATACTTCTGGTTCGAAGAAGG - Intronic
934476874 2:94599532-94599554 TAATGGGTCTGGTGGCAAGAGGG - Intronic
935896203 2:107740331-107740353 TAATGGTTGTGGTATGAAGATGG + Intergenic
937042369 2:118832621-118832643 CATTGGCTAAGGTGGGAAGAAGG + Intergenic
937220732 2:120341947-120341969 CTAGGGTTCTGGCTGGAAGAAGG - Intergenic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
941536342 2:166726560-166726582 GGATGGTGCTGGTGGGAAGGTGG + Intergenic
942533330 2:176935998-176936020 CAATGGTTGTGCTTTGAAGAAGG + Intergenic
942746158 2:179235618-179235640 CAATAGTGCTGTTGAGAAGAGGG - Intronic
943783992 2:191856442-191856464 CTATTGTTCAGGTAGGAAGAAGG + Intergenic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
944305700 2:198176421-198176443 CAATGGTTATCATGGGAAGGGGG - Intronic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
1168976182 20:1967901-1967923 CTATGGTCCAGGTGGCAAGATGG - Intergenic
1169898856 20:10533211-10533233 AAATCACTCTGGTGGGAAGAAGG + Intronic
1170134199 20:13055185-13055207 AAATGGTTCTGTTGGCAAAATGG + Intronic
1170201984 20:13754154-13754176 GAATGGTTTTTGTGGGATGATGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172654109 20:36526395-36526417 CACTGGTTCTGGTTTGCAGAAGG - Intronic
1172800213 20:37571125-37571147 CAATTGTTCAAGTGAGAAGAGGG + Intergenic
1175956397 20:62611829-62611851 CAACAGTTCAGGTGGGAAAATGG + Intergenic
1176271386 20:64236712-64236734 CTTTTGTGCTGGTGGGAAGAAGG + Intronic
1177189108 21:17829983-17830005 CATTTATTCTGGTGGGAAGAAGG - Intergenic
1179246342 21:39637270-39637292 CAATGGCCCTGCTGGGAGGAAGG - Intronic
1181273519 22:21674412-21674434 GAATGGTTGTGTTGGGAAGATGG - Intronic
1182306860 22:29375826-29375848 GAACTGTTCTGGTGGAAAGAAGG + Intronic
1183044258 22:35207225-35207247 CAAGGGTTGTGATGGGAATAAGG - Intergenic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184876771 22:47281281-47281303 CAATTGTTATGCTGGGAAAATGG + Intergenic
1184974125 22:48048810-48048832 CAAGGCTGCAGGTGGGAAGAGGG + Intergenic
950414033 3:12858185-12858207 CATTGGTTTTGCTGGGAAGGGGG - Intronic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950903411 3:16516477-16516499 GATGGGGTCTGGTGGGAAGAAGG - Intergenic
951604206 3:24414130-24414152 CAATGGCACTGGTGCAAAGAGGG + Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951822499 3:26827837-26827859 CAATGCTGCTGGTGGGGACAGGG - Intergenic
952615749 3:35271519-35271541 CAATTGCTATGGTGGGAAGAAGG + Intergenic
955398992 3:58577786-58577808 AAATGGCTCTGGGGGGAAAAGGG + Intronic
955532561 3:59889311-59889333 CAAAGGTTCTGGTGATAATAGGG + Intronic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
958636869 3:96755907-96755929 CAGTGGCTCTGCTGGGAATATGG + Intergenic
959952388 3:112194037-112194059 AAATGGCTCTGGTGTCAAGATGG + Intronic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
962488096 3:135864333-135864355 CAATTCTTCTAGGGGGAAGAGGG - Intergenic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
966462816 3:180196488-180196510 TAATGGCAATGGTGGGAAGAGGG - Intergenic
967157906 3:186710445-186710467 CAAGGGTGATGGTGGGAAGTGGG - Intergenic
967551857 3:190805093-190805115 CACTGCTTATGGTGGGAAGAAGG + Intergenic
967933341 3:194706642-194706664 CAATAGTCCAGGTGGGATGAAGG + Intergenic
969253149 4:5983176-5983198 CAATGGTTCGGGTGGATTGAAGG - Intronic
969457542 4:7308690-7308712 ACAGGGTGCTGGTGGGAAGAGGG - Intronic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
973329746 4:48901021-48901043 GAATGGTTGTGATGGGCAGAGGG - Intronic
974791994 4:66703622-66703644 GAATGTTTTTGGTGGGGAGAGGG - Intergenic
975571364 4:75821522-75821544 CAAGGGTTATGTTAGGAAGAAGG + Intergenic
975968805 4:80009086-80009108 CAATGGTTCTTGTTGGGAAATGG + Intronic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
983494377 4:168426635-168426657 CAATGCTTCTGCTGGCTAGACGG + Intronic
983954055 4:173676365-173676387 CAATGATTATGGGGGGAGGATGG + Intergenic
984035586 4:174663872-174663894 CAATGGGTCTTTTGGGAAGGTGG - Intronic
986493867 5:8322113-8322135 AACTGGTTCTGGTAGGAATAAGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987162603 5:15159779-15159801 CAATGGTTCTATTGTGAAGGGGG + Intergenic
989375212 5:40754053-40754075 CAGTGGTTTGGGTTGGAAGATGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989735661 5:44701500-44701522 CAAGGGTAAGGGTGGGAAGAGGG - Intergenic
990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG + Intergenic
991188187 5:63835803-63835825 GATTGGTTCTGATGAGAAGAAGG - Intergenic
992549610 5:77848164-77848186 CAATAGCTCTGGTGGAAACAGGG + Intronic
992729509 5:79647073-79647095 ATATGGTTCTGTTGGGAAGCAGG - Intronic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995013819 5:107288050-107288072 GAAGGGTTGTGGTGGGAGGAAGG - Intergenic
995505513 5:112856047-112856069 TCATTGTTGTGGTGGGAAGATGG + Intronic
997963391 5:138338739-138338761 ATATGGTTCTGGTGGGGAAAGGG - Intronic
1002312944 5:178325632-178325654 CAATGGGACTGATGGGCAGACGG - Intronic
1002769399 6:278002-278024 CAATCGTTGTGGTGGGAAGCAGG + Intergenic
1002770097 6:283028-283050 CACTGCTTCTGGTGGGAGGAGGG - Intergenic
1005445678 6:25920061-25920083 ACTTGGTTTTGGTGGGAAGAAGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006938891 6:37738257-37738279 CCATGGTTTTGGTGGGGACAGGG + Intergenic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007899850 6:45400380-45400402 CAATATTTGTGGTGGGAAAAAGG - Intronic
1008011314 6:46470687-46470709 CAATAGTTCTATTTGGAAGAAGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010329466 6:74606330-74606352 CAAGGGTTGGGGTTGGAAGAAGG - Intergenic
1015399464 6:132772550-132772572 CAATAGTTCTCATGGGAATAAGG - Intronic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016468545 6:144350315-144350337 CAATGGTTTTGGAGAGAGGAAGG - Intronic
1017298421 6:152827249-152827271 CAATTGTTCTTGTGGAGAGAGGG + Intergenic
1017845958 6:158258496-158258518 CCATGGTAATGGTGGGAGGATGG + Intronic
1018961061 6:168448711-168448733 CAAGGCTTATGGTAGGAAGAGGG - Intronic
1019994966 7:4718062-4718084 CCATGGAGCTGGTGGGAACACGG - Intronic
1020510269 7:9047730-9047752 CAAAGGATCTGGTGGGAGGGGGG + Intergenic
1021736484 7:23643043-23643065 CAATGGTACTAGTGGGAATTTGG + Exonic
1024558882 7:50627390-50627412 CAAAGGTTATGATGGGAAGAGGG - Intronic
1030950239 7:115781771-115781793 CAATGGTTCTGAGGGAAAGCAGG - Intergenic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1034350408 7:150411459-150411481 GACTGGTTCAGGTGTGAAGATGG - Intronic
1035333865 7:158113339-158113361 CCAGGGTTCTGGGGGCAAGAGGG + Intronic
1035930001 8:3770088-3770110 CAATCGCTCTGATGGAAAGAAGG - Intronic
1038041503 8:23727587-23727609 GACTGGTTGTGGTGGGGAGAAGG - Intergenic
1038408039 8:27336719-27336741 AAAGGGTTCTGGTGACAAGAAGG - Intronic
1039418790 8:37418665-37418687 CAGTGGTTCTGGTTGGGATATGG - Intergenic
1043291561 8:78608107-78608129 CAATACATCTGGTGGCAAGATGG - Intergenic
1045246000 8:100442169-100442191 AATTAGGTCTGGTGGGAAGAGGG + Intergenic
1045266295 8:100621545-100621567 CTAAGGTGCTGGTGGTAAGATGG - Intronic
1045707398 8:104942047-104942069 TCATGGTTCTGGTAGGATGATGG - Intronic
1046508258 8:115164406-115164428 AAATGGCTCTGGGGGGAGGAAGG + Intergenic
1048323637 8:133421993-133422015 CAATTGTTCAGTTGGCAAGACGG - Intergenic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1050456504 9:5839807-5839829 CAATGGATCTTGTAGGAAAATGG + Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052393677 9:27911633-27911655 CAAAGGTTCTGGGGGAGAGAGGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1053302043 9:36959170-36959192 AGAAGGGTCTGGTGGGAAGAGGG - Intronic
1053681191 9:40486548-40486570 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1053931180 9:43114872-43114894 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054282523 9:63138386-63138408 TAATGGGTCTGGTGGTAAGAGGG - Intergenic
1054294278 9:63322063-63322085 TAACGGGTCTGGTGGTAAGAGGG + Intergenic
1054392300 9:64626552-64626574 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054426948 9:65131763-65131785 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054503427 9:65889777-65889799 TAATGGGTCTGGTGGTAAGAGGG - Intronic
1054864744 9:69988504-69988526 CAATAGTGCTGCTAGGAAGATGG - Intergenic
1055657537 9:78466659-78466681 TAATGGTGCTGTTGGGAAGATGG + Intergenic
1057977554 9:99622436-99622458 GAATGTTTCTGGTGGAAACAGGG - Intergenic
1058766642 9:108188597-108188619 GAATGGTTCTTGTGTGAATATGG - Intergenic
1059056348 9:110985085-110985107 AAATGGTTCAGCTGGGATGAAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1185820268 X:3196214-3196236 TAATGGTTCTTGTGGTAATAGGG - Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1192083138 X:68067469-68067491 CAATGATTTTGGGGGGCAGAGGG + Intronic
1193014304 X:76715077-76715099 CAAGGGTTCTTGTGGGAAATAGG + Intergenic
1193134026 X:77949611-77949633 CAATTCTACTGGTGGGAACAAGG + Intronic
1195553727 X:106197517-106197539 CACTGGTTCTGGTATGCAGAAGG - Intronic
1201347538 Y:13001080-13001102 CAATGGATTTGTTGGGAAAAAGG - Intergenic