ID: 1051331568

View in Genome Browser
Species Human (GRCh38)
Location 9:16029516-16029538
Sequence CTGCTAAGGTTGAGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051331559_1051331568 23 Left 1051331559 9:16029470-16029492 CCACATCTGGGCTCACGGGAAAA 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051331568 Original CRISPR CTGCTAAGGTTGAGGGAATA GGG Intronic
No off target data available for this crispr