ID: 1051334649

View in Genome Browser
Species Human (GRCh38)
Location 9:16054974-16054996
Sequence GTGGATGCAGAGAGGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051334647_1051334649 -10 Left 1051334647 9:16054961-16054983 CCTCGGGGCAAGGGTGGATGCAG 0: 1
1: 0
2: 1
3: 13
4: 230
Right 1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG No data
1051334646_1051334649 -9 Left 1051334646 9:16054960-16054982 CCCTCGGGGCAAGGGTGGATGCA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG No data
1051334638_1051334649 22 Left 1051334638 9:16054929-16054951 CCTTGGTGAGAACTTAACGTGGA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG No data
1051334645_1051334649 -8 Left 1051334645 9:16054959-16054981 CCCCTCGGGGCAAGGGTGGATGC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051334649 Original CRISPR GTGGATGCAGAGAGGCCAGT TGG Intronic
No off target data available for this crispr