ID: 1051341750

View in Genome Browser
Species Human (GRCh38)
Location 9:16118663-16118685
Sequence CCACCCATAAATTCAAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051341750_1051341761 28 Left 1051341750 9:16118663-16118685 CCCCTTTTTGAATTTATGGGTGG No data
Right 1051341761 9:16118714-16118736 AGAGCTGGCATCCGCAGAACAGG No data
1051341750_1051341756 13 Left 1051341750 9:16118663-16118685 CCCCTTTTTGAATTTATGGGTGG No data
Right 1051341756 9:16118699-16118721 CAGCCAACCATGCCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051341750 Original CRISPR CCACCCATAAATTCAAAAAG GGG (reversed) Intergenic
No off target data available for this crispr