ID: 1051342737

View in Genome Browser
Species Human (GRCh38)
Location 9:16126953-16126975
Sequence TTCTGGTTTCATCTTAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051342737_1051342741 6 Left 1051342737 9:16126953-16126975 CCTCTCTTAAGATGAAACCAGAA No data
Right 1051342741 9:16126982-16127004 CCTCCTAGCTGATTGCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051342737 Original CRISPR TTCTGGTTTCATCTTAAGAG AGG (reversed) Intergenic
No off target data available for this crispr