ID: 1051343741

View in Genome Browser
Species Human (GRCh38)
Location 9:16134022-16134044
Sequence CCGTGCTCACTTAGTGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051343741_1051343751 24 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343751 9:16134069-16134091 AGATTACGGGGCAGGTTCACCGG No data
1051343741_1051343749 16 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343749 9:16134061-16134083 TTCCGCACAGATTACGGGGCAGG No data
1051343741_1051343747 11 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343747 9:16134056-16134078 GTAAATTCCGCACAGATTACGGG No data
1051343741_1051343752 25 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343752 9:16134070-16134092 GATTACGGGGCAGGTTCACCGGG No data
1051343741_1051343746 10 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343746 9:16134055-16134077 AGTAAATTCCGCACAGATTACGG No data
1051343741_1051343748 12 Left 1051343741 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG No data
Right 1051343748 9:16134057-16134079 TAAATTCCGCACAGATTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051343741 Original CRISPR CCGTGCTCACTTAGTGCCTG CGG (reversed) Intergenic
No off target data available for this crispr