ID: 1051344088

View in Genome Browser
Species Human (GRCh38)
Location 9:16136993-16137015
Sequence GCTCCTAGGGTGTCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051344088_1051344092 0 Left 1051344088 9:16136993-16137015 CCTGGCTGTGACACCCTAGGAGC No data
Right 1051344092 9:16137016-16137038 TCCCCTCCAACCTCATCTGTGGG No data
1051344088_1051344091 -1 Left 1051344088 9:16136993-16137015 CCTGGCTGTGACACCCTAGGAGC No data
Right 1051344091 9:16137015-16137037 CTCCCCTCCAACCTCATCTGTGG No data
1051344088_1051344098 18 Left 1051344088 9:16136993-16137015 CCTGGCTGTGACACCCTAGGAGC No data
Right 1051344098 9:16137034-16137056 GTGGGTGTTATGCAATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051344088 Original CRISPR GCTCCTAGGGTGTCACAGCC AGG (reversed) Intergenic
No off target data available for this crispr