ID: 1051345609

View in Genome Browser
Species Human (GRCh38)
Location 9:16148094-16148116
Sequence AGGGAGAGTGCAGTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051345594_1051345609 28 Left 1051345594 9:16148043-16148065 CCAGCCCCCAGCATCGATCCTGC No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345598_1051345609 21 Left 1051345598 9:16148050-16148072 CCAGCATCGATCCTGCTGCACAG No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345595_1051345609 24 Left 1051345595 9:16148047-16148069 CCCCCAGCATCGATCCTGCTGCA No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345593_1051345609 29 Left 1051345593 9:16148042-16148064 CCCAGCCCCCAGCATCGATCCTG No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345599_1051345609 10 Left 1051345599 9:16148061-16148083 CCTGCTGCACAGAGAAATCTGTG No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345596_1051345609 23 Left 1051345596 9:16148048-16148070 CCCCAGCATCGATCCTGCTGCAC No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345597_1051345609 22 Left 1051345597 9:16148049-16148071 CCCAGCATCGATCCTGCTGCACA No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data
1051345592_1051345609 30 Left 1051345592 9:16148041-16148063 CCCCAGCCCCCAGCATCGATCCT No data
Right 1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051345609 Original CRISPR AGGGAGAGTGCAGTGGGTGG GGG Intergenic
No off target data available for this crispr