ID: 1051346702

View in Genome Browser
Species Human (GRCh38)
Location 9:16157542-16157564
Sequence GAAGCTGATTTCACTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051346702_1051346704 15 Left 1051346702 9:16157542-16157564 CCAGCTGTAGTGAAATCAGCTTC No data
Right 1051346704 9:16157580-16157602 GATAATGGTAGAAAACATTTAGG No data
1051346702_1051346703 0 Left 1051346702 9:16157542-16157564 CCAGCTGTAGTGAAATCAGCTTC No data
Right 1051346703 9:16157565-16157587 TCATGTTTGCTGCTAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051346702 Original CRISPR GAAGCTGATTTCACTACAGC TGG (reversed) Intergenic
No off target data available for this crispr