ID: 1051351137

View in Genome Browser
Species Human (GRCh38)
Location 9:16198863-16198885
Sequence TGGATTTACATGCAAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051351137_1051351140 -7 Left 1051351137 9:16198863-16198885 CCACCCGCTTGCATGTAAATCCA No data
Right 1051351140 9:16198879-16198901 AAATCCAATGACAGCTTCTAAGG No data
1051351137_1051351142 6 Left 1051351137 9:16198863-16198885 CCACCCGCTTGCATGTAAATCCA No data
Right 1051351142 9:16198892-16198914 GCTTCTAAGGCCACCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051351137 Original CRISPR TGGATTTACATGCAAGCGGG TGG (reversed) Intergenic
No off target data available for this crispr