ID: 1051351140

View in Genome Browser
Species Human (GRCh38)
Location 9:16198879-16198901
Sequence AAATCCAATGACAGCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051351138_1051351140 -10 Left 1051351138 9:16198866-16198888 CCCGCTTGCATGTAAATCCAATG No data
Right 1051351140 9:16198879-16198901 AAATCCAATGACAGCTTCTAAGG No data
1051351137_1051351140 -7 Left 1051351137 9:16198863-16198885 CCACCCGCTTGCATGTAAATCCA No data
Right 1051351140 9:16198879-16198901 AAATCCAATGACAGCTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051351140 Original CRISPR AAATCCAATGACAGCTTCTA AGG Intergenic
No off target data available for this crispr