ID: 1051351142

View in Genome Browser
Species Human (GRCh38)
Location 9:16198892-16198914
Sequence GCTTCTAAGGCCACCACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051351137_1051351142 6 Left 1051351137 9:16198863-16198885 CCACCCGCTTGCATGTAAATCCA No data
Right 1051351142 9:16198892-16198914 GCTTCTAAGGCCACCACAAAAGG No data
1051351139_1051351142 2 Left 1051351139 9:16198867-16198889 CCGCTTGCATGTAAATCCAATGA No data
Right 1051351142 9:16198892-16198914 GCTTCTAAGGCCACCACAAAAGG No data
1051351138_1051351142 3 Left 1051351138 9:16198866-16198888 CCCGCTTGCATGTAAATCCAATG No data
Right 1051351142 9:16198892-16198914 GCTTCTAAGGCCACCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051351142 Original CRISPR GCTTCTAAGGCCACCACAAA AGG Intergenic
No off target data available for this crispr