ID: 1051351442

View in Genome Browser
Species Human (GRCh38)
Location 9:16201508-16201530
Sequence ATGTTGTTCCTGATGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051351442_1051351443 -5 Left 1051351442 9:16201508-16201530 CCTTTTTTCATCAGGAACAACAT No data
Right 1051351443 9:16201526-16201548 AACATCAAGAGCTCATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051351442 Original CRISPR ATGTTGTTCCTGATGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr