ID: 1051352972

View in Genome Browser
Species Human (GRCh38)
Location 9:16215609-16215631
Sequence GGCCCCAGGAGACAACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051352967_1051352972 25 Left 1051352967 9:16215561-16215583 CCAGCATGGTGCAGAGTGGTCTG 0: 1
1: 0
2: 0
3: 4
4: 186
Right 1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 142
1051352969_1051352972 0 Left 1051352969 9:16215586-16215608 CCGCACAAAACAAATCAAAATAT 0: 1
1: 0
2: 8
3: 158
4: 1677
Right 1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051352972 Original CRISPR GGCCCCAGGAGACAACTTGC TGG Intronic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900635485 1:3662815-3662837 GGCCCCAGGACAGACCTGGCTGG + Intronic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
904013537 1:27403939-27403961 GGCCTCAGGAGACAATCTGCTGG - Intergenic
907915660 1:58866546-58866568 GGGCCCAGGATATAATTTGCGGG - Intergenic
909131296 1:71740537-71740559 GGCCCCAGGAAACATCTTTGTGG - Intronic
911812412 1:102299732-102299754 GTACCCAGGAGTCAAATTGCTGG - Intergenic
912699251 1:111864257-111864279 GGCCCCAAGAGCCAACTTTGTGG + Intronic
913009570 1:114669992-114670014 GGCCACAGGAGACAACGTTGAGG - Exonic
913423468 1:118699550-118699572 CTACGCAGGAGACAACTTGCTGG + Intergenic
916809566 1:168293479-168293501 GGCACCAGGAGAGCACATGCTGG - Intronic
917936568 1:179873864-179873886 GGACCCAAGAGCCAACTTGAAGG - Intronic
918267086 1:182853358-182853380 GGACCGAGGAGCCAACTTGAAGG + Exonic
919773850 1:201180803-201180825 AGCCCCAGGAGAGAACCAGCAGG + Intergenic
1063114916 10:3066864-3066886 CGCCCCAGGAGGAATCTTGCGGG + Intronic
1063408673 10:5819720-5819742 GGATCTAGGAGAGAACTTGCTGG - Intronic
1065709729 10:28504212-28504234 GGCCCCAAGAAACCACTGGCAGG + Intergenic
1067027837 10:42859258-42859280 GGCCCCAGTTGACACCTTCCTGG - Intergenic
1067318742 10:45198176-45198198 GGCCCAGGGAGACAACTTTGTGG + Intergenic
1074634172 10:115295184-115295206 AGGCCCAGGAGACAAGTTGAAGG + Intronic
1075093363 10:119455757-119455779 GGCCCCAGGAGAGGACATTCTGG - Intronic
1080353585 11:31414645-31414667 GGGCACAGGAGACAACTGCCAGG - Intronic
1080920296 11:36702013-36702035 GGCCCCAGCAAACATGTTGCTGG - Intergenic
1081227581 11:40543310-40543332 GGCCAAAGTAGACAATTTGCAGG + Intronic
1081304762 11:41498220-41498242 GGAGCCAGAAGACAGCTTGCTGG - Intergenic
1082941514 11:58710022-58710044 GGCCCCAGGAGACAGCAGGTGGG + Exonic
1083266143 11:61547754-61547776 AGGCCCAGGTGCCAACTTGCTGG + Intronic
1083341116 11:61959032-61959054 GGGTCCAGGGGACATCTTGCAGG - Intronic
1083928109 11:65821434-65821456 GTTCCCAGGGGAGAACTTGCAGG + Intergenic
1084605541 11:70169713-70169735 AGCCCAGGGAGAGAACTTGCAGG + Intronic
1086842689 11:91706862-91706884 GGACCCAAGAGACAACGTGGTGG - Intergenic
1087567103 11:99874873-99874895 GGCTCCAGGAGCCTACTTGAAGG - Intronic
1087647318 11:100823299-100823321 TGCCCTGGAAGACAACTTGCAGG + Intronic
1089173307 11:116530997-116531019 GTCCCCAGGAGAGGGCTTGCTGG - Intergenic
1089630957 11:119783811-119783833 AGACCCAGGAGACAGCCTGCAGG - Intergenic
1090509665 11:127361435-127361457 GGACCCAGGGAACAACCTGCAGG - Intergenic
1091807796 12:3368032-3368054 GCCCCCAGTAGACCCCTTGCAGG + Intergenic
1093177930 12:15934241-15934263 GGCCTCAGTAGACAGCCTGCGGG + Intronic
1097279778 12:57837761-57837783 GGCACCAGCATACAACATGCTGG - Intronic
1098331295 12:69356483-69356505 TGGCACAGAAGACAACTTGCAGG - Intergenic
1098383587 12:69895531-69895553 GGCCCCAGGAGGGCACTTCCTGG - Intronic
1102378672 12:112444791-112444813 GGACACAGGAGACAAACTGCAGG - Intronic
1110569088 13:76985270-76985292 GGACCAAGGAGCCAACTTGAAGG + Intergenic
1113485013 13:110646938-110646960 GGCCCCAGGAGACAGGGTGCTGG - Intronic
1120429598 14:84398615-84398637 GGCCTCAGGAGAGAAGCTGCAGG + Intergenic
1120574664 14:86167695-86167717 GGCTCTAGGAGAGGACTTGCAGG - Intergenic
1122593550 14:102872561-102872583 GGCCCCAGGAGAGAAGCTGGTGG - Intronic
1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG + Intergenic
1122992011 14:105240956-105240978 GGCCCCACGAGACCACGGGCAGG + Intronic
1123024515 14:105418485-105418507 GGTCCCAGGACACATCCTGCGGG - Intronic
1126412688 15:48388359-48388381 TGCCACAGCAGACAACATGCAGG - Intergenic
1126611236 15:50531701-50531723 GGCCCCAGGAGCTGACTTGAAGG + Intronic
1129155453 15:73714549-73714571 GGCCCCAGGACTCAACCAGCAGG + Intergenic
1133115714 16:3577002-3577024 TGCCCCAGGAGACAGCTTCTTGG + Intronic
1135503831 16:23019520-23019542 GGCCACAGGAAACACCTTTCAGG - Intergenic
1136618644 16:31413444-31413466 GGGCCCAGGAGAGAACTGGGTGG - Intronic
1136856807 16:33665721-33665743 GGCCCCAGTTGACACCTTCCTGG + Intergenic
1141781392 16:86163998-86164020 GGGCCCAGGAGACCCCTTCCAGG - Intergenic
1143553868 17:7648900-7648922 GGCTCCAGGAGAGAACTAGTCGG - Intronic
1143904600 17:10198685-10198707 GGGCTCCGGAGACAACTTCCCGG + Intergenic
1144659121 17:17057070-17057092 GACCCCAGGAGAGGACTTGCTGG + Intronic
1147685557 17:42284804-42284826 GGCACCAGGATCCAAGTTGCCGG - Intergenic
1149653272 17:58292349-58292371 GGCTCCAGGAGAAAACTCTCTGG + Intergenic
1151332309 17:73417612-73417634 GGTCCCAGGGCAGAACTTGCAGG + Intronic
1151960918 17:77405237-77405259 GGCCCAGGGACACAACCTGCGGG + Intronic
1154235417 18:12601078-12601100 GGACTCAGGAGTCAGCTTGCAGG - Intronic
1155012724 18:21796820-21796842 GGACCTAGGAGCCAACTTGAAGG + Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1157721609 18:49929477-49929499 AGCCCCAGGAGGCAGCTGGCGGG + Intronic
1160675701 19:390133-390155 GGCCCCAGGAGAGAAATGGATGG - Intergenic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160938740 19:1610182-1610204 GGCCCGAGGGGACACCCTGCTGG + Exonic
1161089396 19:2352563-2352585 GGCCCCAGGAGACTTCTCCCTGG - Intronic
1165209474 19:34222241-34222263 TGACTCAGGAAACAACTTGCTGG - Intronic
1166246563 19:41531631-41531653 GCCCCCAGGAGAGAGGTTGCTGG + Intergenic
1166419044 19:42620360-42620382 TGCCCCAGGAGCCAACTCTCAGG + Intronic
1166561618 19:43736419-43736441 GGCCCCAGGAGACCGCTGGGAGG - Intronic
1168340460 19:55620434-55620456 GGCCCCATGAGATAACTCACAGG - Intergenic
930059590 2:47277139-47277161 GTCCCCAGGTGACAGCTTTCAGG + Intergenic
932413035 2:71558466-71558488 GGCACCATGAGTCACCTTGCAGG - Intronic
933047210 2:77554120-77554142 GGCAACAGGAGACTACTTGATGG - Intronic
935931814 2:108134622-108134644 GCCCCCAGCAGACAACTGCCAGG - Intergenic
937228302 2:120382388-120382410 GGCCACAGCATAGAACTTGCAGG - Intergenic
938195857 2:129327311-129327333 AGCCCCTGGAGGCAACTTCCAGG + Intergenic
942377498 2:175352617-175352639 GGACCCAGCAGACAAAGTGCAGG - Intergenic
942416965 2:175769758-175769780 GGACCCAGGTCACAGCTTGCTGG - Intergenic
946088555 2:217198740-217198762 GGCACCAGCAGACAACTGTCTGG + Intergenic
946115854 2:217461447-217461469 GCCCACAGGAGACTGCTTGCTGG - Intronic
947534689 2:230933364-230933386 GGTCCCAGGAGACGGTTTGCAGG - Intronic
948220025 2:236262329-236262351 GGCTACAGGAGACCACTTACAGG + Intronic
948601354 2:239109106-239109128 GGCCCCTGGTGACACCTGGCAGG + Intronic
1169983729 20:11418558-11418580 GGACAAAGGAGACAACATGCAGG - Intergenic
1170858906 20:20084542-20084564 GGCCCCAGAGGAAAACCTGCAGG - Intronic
1173784378 20:45782108-45782130 GGCCCAAGAAGACAACTGTCAGG + Intronic
1174643297 20:52063747-52063769 GGACCCAGGAGCCAACTTGGAGG + Intronic
1175722522 20:61295831-61295853 GACCCCAGGACACACCCTGCTGG - Intronic
1177134848 21:17297756-17297778 GGACCCAGGAGACAAGTGTCAGG - Intergenic
1178906587 21:36642036-36642058 GGCCCCAGGAGTCCACAGGCAGG - Intergenic
1179422913 21:41250283-41250305 TGCACCAGGAGGCAACTTGCTGG + Intronic
1179507160 21:41849192-41849214 GGCCGCACGAGAGAACTTCCTGG + Intronic
1183366560 22:37410118-37410140 GGCCGCAGGAGAGAGCTGGCTGG - Intronic
1184105133 22:42363010-42363032 GGGCCCAGGAGGCAGGTTGCTGG - Intergenic
1184361816 22:44023747-44023769 GGCCCCAGGAAATGGCTTGCAGG - Intronic
1185165837 22:49261670-49261692 GGGCTCAGGAGACAACCTGAGGG + Intergenic
953529093 3:43723076-43723098 GGACCCAGGAGCTAACTTGAAGG + Intronic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
963008538 3:140748825-140748847 TGCCCCAGGACACACCTAGCTGG - Intergenic
963629591 3:147716394-147716416 GGATACAGGAGACAACTTGAAGG + Intergenic
963701412 3:148630773-148630795 GGCCCGAGGAGACAGCTGCCTGG - Intergenic
968290297 3:197533656-197533678 GGCTCCTGGAGACAGCTTGCTGG + Intronic
972698928 4:41475061-41475083 GGCACCAAGAGACAATTTTCAGG + Intronic
972862197 4:43183777-43183799 GGACACAGGAGTCAACTTGAAGG - Intergenic
979525255 4:121709300-121709322 GAGCCCAGCAGAAAACTTGCAGG - Intergenic
982629941 4:157819493-157819515 GGCCACAGGGGACACCCTGCTGG - Intergenic
986503895 5:8429823-8429845 GGCCCCGGGAGACAGGTTCCTGG - Intergenic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
992013731 5:72556081-72556103 GGCCCCAGGGGGAAACCTGCTGG - Intergenic
997143228 5:131405593-131405615 GGCCACAGCAGACACCTTGTGGG - Intergenic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
998046340 5:138990093-138990115 GGGACCAGGAGTAAACTTGCTGG - Intronic
998146794 5:139733761-139733783 GGCCTCAGGATAAAACCTGCCGG - Intergenic
998755972 5:145379767-145379789 GGTCACAGGAGCCAACCTGCAGG + Intergenic
999290546 5:150422648-150422670 GGACCCAGGAGCCAACTTGAAGG + Intergenic
999903845 5:156117702-156117724 TGCCCAAGGACACAACTTGGGGG + Intronic
1001559372 5:172659300-172659322 AGCCCCAGGAGAGCACCTGCGGG - Intronic
1001999576 5:176190159-176190181 GGCCCCAGGTGTGAAATTGCTGG - Intergenic
1002564233 5:180100917-180100939 GGCCCCAGGAGATAGCTTTCCGG - Exonic
1006390466 6:33755240-33755262 GGCCGGAGGAGGCCACTTGCAGG + Intergenic
1018624191 6:165761454-165761476 GGGCCCAGCAGACATCTTGTGGG - Intronic
1019196496 6:170286365-170286387 GGGGCCAGGACACAACTCGCCGG + Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1033584479 7:142763831-142763853 AGCCCCAGGAGACAACTCCTTGG - Intronic
1036189365 8:6656268-6656290 GGCCCCAGGACAGAACCTTCTGG - Intergenic
1036759007 8:11494168-11494190 AACCCCAGGAGAAAACTTTCTGG + Exonic
1038118154 8:24581394-24581416 GCCTCCAGGAGACATCTTGCAGG - Intergenic
1047514390 8:125541110-125541132 GGCCACAGGTGACATCTTGTGGG - Intergenic
1048899107 8:139021124-139021146 GGCCCCAGTAGACATTTAGCTGG + Intergenic
1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG + Intronic
1052852791 9:33387934-33387956 GGCCGCAGGAGAGAACACGCTGG + Intronic
1052901697 9:33799066-33799088 GGCCCCAGGAGACAACTCCTTGG - Exonic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1059294403 9:113256897-113256919 GGGCCCAGGAGAAAAGTTGATGG + Intronic
1060708457 9:125831779-125831801 GGACACAGGAGCCAACTTGAAGG - Intronic
1061444541 9:130630535-130630557 GGCTCCAGAAGACAACTCGGGGG - Intronic
1061560950 9:131402804-131402826 GGTCCCAGAAGAGAACTTGTGGG + Intronic
1061914391 9:133741807-133741829 GGCCCCAGGCCACAACTGCCAGG - Intergenic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1062052275 9:134453802-134453824 GGCCCCAGGTGAGCACTGGCCGG + Intergenic
1062280700 9:135750481-135750503 GGCCACAGGGGAGACCTTGCTGG - Intronic
1185568069 X:1111915-1111937 GACCCCAGGAGAGAAGCTGCCGG - Intergenic
1194810603 X:98382847-98382869 GGCCCAAGCAGGCAACTTGAAGG - Intergenic
1199748834 X:150795214-150795236 GGCCGCAGGAAACCAATTGCTGG - Exonic
1200083498 X:153591375-153591397 GCCGCCAGCAAACAACTTGCTGG + Intronic