ID: 1051353109

View in Genome Browser
Species Human (GRCh38)
Location 9:16216835-16216857
Sequence GGCATCCTCTCCCCTGTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051353109_1051353112 -2 Left 1051353109 9:16216835-16216857 CCGTGGACAGGGGAGAGGATGCC No data
Right 1051353112 9:16216856-16216878 CCCAGCTCCCAGGCAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051353109 Original CRISPR GGCATCCTCTCCCCTGTCCA CGG (reversed) Intronic