ID: 1051353109 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:16216835-16216857 |
| Sequence | GGCATCCTCTCCCCTGTCCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051353109_1051353112 | -2 | Left | 1051353109 | 9:16216835-16216857 | CCGTGGACAGGGGAGAGGATGCC | No data | ||
| Right | 1051353112 | 9:16216856-16216878 | CCCAGCTCCCAGGCAGCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051353109 | Original CRISPR | GGCATCCTCTCCCCTGTCCA CGG (reversed) | Intronic | ||