ID: 1051353209

View in Genome Browser
Species Human (GRCh38)
Location 9:16217775-16217797
Sequence TTCCAGCCGAGGCTCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051353209_1051353216 28 Left 1051353209 9:16217775-16217797 CCAGCATGGAGCCTCGGCTGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051353216 9:16217826-16217848 CAGGCTCTAATGTCAGGCCTTGG No data
1051353209_1051353215 22 Left 1051353209 9:16217775-16217797 CCAGCATGGAGCCTCGGCTGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051353215 9:16217820-16217842 CGAGGACAGGCTCTAATGTCAGG No data
1051353209_1051353214 9 Left 1051353209 9:16217775-16217797 CCAGCATGGAGCCTCGGCTGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051353214 9:16217807-16217829 TTCTGGACAAAGACGAGGACAGG No data
1051353209_1051353212 -8 Left 1051353209 9:16217775-16217797 CCAGCATGGAGCCTCGGCTGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051353212 9:16217790-16217812 GGCTGGAAACTAGAGGATTCTGG No data
1051353209_1051353213 4 Left 1051353209 9:16217775-16217797 CCAGCATGGAGCCTCGGCTGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1051353213 9:16217802-16217824 GAGGATTCTGGACAAAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051353209 Original CRISPR TTCCAGCCGAGGCTCCATGC TGG (reversed) Intronic
900228064 1:1542035-1542057 CTCCAGAGGCGGCTCCATGCGGG + Exonic
901674600 1:10875530-10875552 GCCCAGCCCAGACTCCATGCAGG - Intergenic
901865975 1:12106952-12106974 TTCCAGCCAAGGCTTCCTGCTGG + Intronic
906239048 1:44230272-44230294 TCCCAGCCAAGGCCCCATCCAGG + Intronic
906319272 1:44806503-44806525 CTCGCGCCGGGGCTCCATGCTGG - Exonic
920193971 1:204213828-204213850 ATCCAGGCCAGGCTCCCTGCCGG - Intronic
920771662 1:208892353-208892375 TTCCATCTGTGGCACCATGCGGG + Intergenic
921562709 1:216677397-216677419 TTCCAGCCCAGCCTCCCTGACGG - Exonic
922701230 1:227762299-227762321 TTCTTGAAGAGGCTCCATGCAGG + Intronic
1066264984 10:33767868-33767890 CTCCAGTCCAGGCTCCATTCTGG + Intergenic
1067178351 10:43966372-43966394 TTCTACACGAGGCTCCATGCAGG + Intergenic
1068675354 10:59764288-59764310 TTCCAGGCCAGGCTCCCAGCAGG + Intergenic
1070755175 10:78987628-78987650 TTCCAGCCCTGGGTCCATCCTGG - Intergenic
1072779549 10:98237834-98237856 TTAAAGCCTGGGCTCCATGCAGG - Intronic
1076319232 10:129565966-129565988 TTCCTGCCGGGGCCCCAGGCAGG + Intronic
1078406543 11:11074904-11074926 TTGCAGGCCCGGCTCCATGCGGG + Intergenic
1080551412 11:33376422-33376444 CACCCGCCGCGGCTCCATGCGGG + Intergenic
1085280396 11:75326172-75326194 TAACAGCCAAGGCTCCAGGCTGG + Intronic
1089523522 11:119081565-119081587 TTGCAGCCCAGCCTCCAGGCTGG - Exonic
1090364035 11:126191539-126191561 TCCCAGCCCAGGCACCGTGCAGG + Intergenic
1104259352 12:127168380-127168402 TTCCAGCAGTTGCTCCATGAAGG + Intergenic
1104282729 12:127392539-127392561 TTCCAACCCAGGCTCACTGCAGG - Intergenic
1104460982 12:128955716-128955738 TTCCAGCTGGGACTCCACGCAGG + Intronic
1105858654 13:24391526-24391548 TGCCTCCCGAGGCTCCCTGCAGG + Intergenic
1106248277 13:27966556-27966578 TTCCAGGCGAGTCTCCCTCCCGG - Intronic
1113403580 13:110018148-110018170 CTCCGGCCGTGGTTCCATGCTGG - Intergenic
1117295596 14:54376457-54376479 TTCCAGCTGAAGCTCCAAGATGG + Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123979099 15:25583043-25583065 TCTCAGCCGAGGCTCCCTGTGGG - Intergenic
1125544140 15:40489961-40489983 TTCCAGGAGAGGCTCCAGGGAGG + Intergenic
1126547576 15:49889666-49889688 TTCCAGCCAATGCCCCATCCTGG - Intronic
1129383516 15:75182987-75183009 TTTCAGCAGAGGATCCATGCAGG - Intergenic
1129747265 15:78031922-78031944 TTCCAGGCCAGGCTGCAGGCAGG + Intronic
1130515316 15:84621809-84621831 CTTCAGCCGGGGCTCCATTCTGG + Exonic
1131394582 15:92076520-92076542 TTCATGCCCAGGCCCCATGCAGG - Intronic
1135142827 16:19936159-19936181 CTCCAGCCCAGCCTCCTTGCTGG + Intergenic
1137346519 16:47666722-47666744 TTCCAAACAAGGCCCCATGCTGG - Intronic
1137763935 16:50963148-50963170 TTCCAGCCCAGTCACTATGCTGG + Intergenic
1140623940 16:76769778-76769800 TTCAAGCCATGCCTCCATGCTGG - Intergenic
1142117059 16:88363872-88363894 TTCCAGACCAGCCTGCATGCAGG - Intergenic
1142929418 17:3270150-3270172 TTCCAGCCCAGGCTCCAGAGAGG - Intergenic
1142968243 17:3594255-3594277 TTCCAGCAGTGGCTACATTCCGG + Intronic
1145888440 17:28398351-28398373 TTCCAGCTGGGGCTGGATGCTGG - Exonic
1148050222 17:44766499-44766521 TTCCACCCGAGGCTCCTCTCTGG - Intronic
1148794621 17:50191079-50191101 TTCCACCTGAGTCTCCAGGCAGG - Intronic
1149524147 17:57340922-57340944 TTCCTGCTGAGGCTCCCTGCAGG - Intronic
1149996499 17:61408629-61408651 TGCCAGACGAGGCTCTATTCCGG - Exonic
1150388537 17:64778329-64778351 CTCGAGCCCAGGCTCCCTGCGGG + Intergenic
1151574784 17:74947334-74947356 TCCCCGCAGAGGCTCCTTGCTGG + Exonic
1153911906 18:9711955-9711977 TTTCAGCACAGGCTCCCTGCTGG + Intronic
1153940151 18:9970054-9970076 TTCCAGAAAAGTCTCCATGCAGG - Intergenic
1157617969 18:48998557-48998579 TCTCAGCCTCGGCTCCATGCTGG + Intergenic
1164934771 19:32202030-32202052 GTCCAGCCCAGGCCCCATCCCGG - Intergenic
1165419650 19:35716599-35716621 TCCCAGCCTGGCCTCCATGCAGG + Exonic
927913241 2:26916210-26916232 TTCCAACCCAGGCTCCAGTCAGG + Intronic
929882831 2:45852073-45852095 TACCAGCGGAGGCTAAATGCCGG - Intronic
932810641 2:74822856-74822878 CTCCAGGCCAGGCTCCAGGCTGG - Intergenic
935619408 2:105115724-105115746 TCCCAGCCCAGGAGCCATGCCGG - Intergenic
940906671 2:159175731-159175753 TTCCAGCAGAGGTGCCATGTGGG - Intronic
946608009 2:221427115-221427137 TTCCAGCCTAGTCTACAGGCAGG + Intronic
946971211 2:225093747-225093769 TTGCAGCTGAGGCACCCTGCAGG + Intergenic
948353617 2:237360326-237360348 TTCCAGGCCAGGCCTCATGCAGG - Intronic
1171185405 20:23120972-23120994 TCCCAGCCCAGGGTCCCTGCTGG - Intergenic
1171318467 20:24217446-24217468 TTCCAGACATGGCTGCATGCAGG + Intergenic
1171435536 20:25120029-25120051 CTCCAGCCTAGGCTCTGTGCAGG - Intergenic
1173835041 20:46119306-46119328 TTCCTGCCCAGGCTTCAGGCAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174339971 20:49889395-49889417 CTCTAGCCCAGGGTCCATGCTGG - Exonic
1175621136 20:60448546-60448568 CCCCAGCCAAGGCTCCTTGCTGG - Intergenic
1179045843 21:37844427-37844449 TTGTAGCTGAGGCTCCAAGCAGG - Intronic
1182034655 22:27188398-27188420 TATCAGTCCAGGCTCCATGCAGG - Intergenic
1182252396 22:29011432-29011454 TGCCAGCCAAGGCTGCATCCTGG - Intronic
1183778056 22:39980764-39980786 TTCCAGGCATGGCTCTATGCAGG + Intergenic
1184260868 22:43315140-43315162 TTCCAGCAAAGGCTTCAAGCTGG - Intronic
1184311182 22:43644096-43644118 TTCCAGGCGTGGCTGCGTGCGGG + Intronic
1185038243 22:48490475-48490497 CCCCTGCCGAGGCTCCAGGCGGG + Intronic
1185044712 22:48523178-48523200 CTCCAGCAGAGGCTCCGTGCAGG - Intronic
950482170 3:13250957-13250979 GTCCAGAAGAGGCTCCCTGCCGG + Intergenic
951170543 3:19536915-19536937 GTCCAGCTGCAGCTCCATGCAGG - Intergenic
953058490 3:39406975-39406997 CTCCAGCGGAGGCTCCGAGCTGG + Intronic
960919365 3:122731042-122731064 TTTCAGCCGGGGCTACTTGCTGG - Intergenic
961018588 3:123485680-123485702 TTCCAGCTGCATCTCCATGCTGG - Intergenic
968880180 4:3294561-3294583 ATCCAGCTGAGGCACCACGCAGG - Intronic
969056124 4:4403954-4403976 TTCCAGCTTAGGCTACATGCGGG + Intronic
970403850 4:15743579-15743601 TTCCCGCAGAGGCTCCCAGCTGG - Intergenic
970491077 4:16574093-16574115 TATCAGCGGAGGCTACATGCAGG + Intronic
970609181 4:17709582-17709604 TTCCCGCAGCGCCTCCATGCTGG + Exonic
984950659 4:185005188-185005210 CTCCAGCCTAGGCTCCACCCAGG + Intergenic
994301378 5:98152308-98152330 TTCCAGCCCAGCCTGCCTGCTGG + Intergenic
996405680 5:123100009-123100031 TGCCGGCCAAGGCTCCCTGCTGG - Intronic
996482195 5:123988242-123988264 TTCCCCCAGAGGCTCCATCCCGG + Intergenic
997192393 5:131949228-131949250 TTGGAGCCGAGGCTCCATAGAGG + Intronic
997302102 5:132813736-132813758 TTCAAGCCGCTGCTCGATGCCGG + Exonic
997641231 5:135450075-135450097 TTCCAGCCTTGGCTCCATCCTGG - Intronic
1002493512 5:179596690-179596712 CCCCAGCCCAGGCTCCCTGCAGG - Intronic
1003427931 6:6009554-6009576 CTGCAGTCCAGGCTCCATGCAGG + Intergenic
1004603892 6:17176047-17176069 TTCCTGTAGATGCTCCATGCTGG - Intergenic
1006766443 6:36510590-36510612 TCCCAGCAGAGGCTCCAGACAGG + Intronic
1007181406 6:39931851-39931873 CTCCCTCTGAGGCTCCATGCAGG - Intronic
1008564810 6:52756732-52756754 TTACAGCAGAGGCTCCTTGGTGG - Intronic
1008569142 6:52798058-52798080 TTACAGCAGAGGCTCCTTGGTGG - Intronic
1015681974 6:135818441-135818463 TTCCACAAGAGGCACCATGCAGG + Intergenic
1026179283 7:68024324-68024346 TTCCAGCCGAGGCTGATTTCTGG - Intergenic
1026352067 7:69526226-69526248 TTACAGCAGAGGTTCCATGTTGG - Intergenic
1027190019 7:75991124-75991146 TCCCAGCAGAGGCTGCAGGCAGG - Intronic
1033440402 7:141373366-141373388 TTCCAACTGTGGCTCCATACTGG - Intronic
1034345774 7:150384335-150384357 TTCCAGCCGGGGCGCTTTGCTGG + Intronic
1043495690 8:80797623-80797645 TTCCTGCCCAGGGTCCTTGCAGG - Intronic
1051353209 9:16217775-16217797 TTCCAGCCGAGGCTCCATGCTGG - Intronic
1060423051 9:123483248-123483270 GTCCAGCAGAGGCCCCATGCAGG + Intronic
1060471346 9:123951148-123951170 TGCCTGCCCAGGCTCCATGGAGG - Intergenic
1060750444 9:126165154-126165176 TTCAAGCAGAGGCTCAAAGCAGG + Intergenic
1061111824 9:128578058-128578080 TTCCAGCGGAGGTTCCAGGGTGG - Intronic
1188326306 X:28806480-28806502 TTCCAGCCACGCTTCCATGCAGG - Intronic
1192481914 X:71492946-71492968 TTCCAGCCGCGGAGCAATGCCGG - Intronic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic
1200247093 X:154532074-154532096 CTCCAGCCGAGGCCCCACGGAGG - Exonic
1200469840 Y:3571534-3571556 TTTCAGCTGATTCTCCATGCAGG + Intergenic