ID: 1051356433

View in Genome Browser
Species Human (GRCh38)
Location 9:16243626-16243648
Sequence GCCACTCTAATGACCAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051356429_1051356433 16 Left 1051356429 9:16243587-16243609 CCAGAAACAGGTTGTGGTAGACT 0: 1
1: 0
2: 0
3: 19
4: 101
Right 1051356433 9:16243626-16243648 GCCACTCTAATGACCAGATCAGG No data
1051356428_1051356433 17 Left 1051356428 9:16243586-16243608 CCCAGAAACAGGTTGTGGTAGAC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1051356433 9:16243626-16243648 GCCACTCTAATGACCAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051356433 Original CRISPR GCCACTCTAATGACCAGATC AGG Intronic
No off target data available for this crispr