ID: 1051357632

View in Genome Browser
Species Human (GRCh38)
Location 9:16254374-16254396
Sequence ACCTGGGGAGAAAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 1, 1: 0, 2: 9, 3: 77, 4: 727}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051357632_1051357639 -6 Left 1051357632 9:16254374-16254396 CCAGCTTCCCTTTCTCCCCAGGT 0: 1
1: 0
2: 9
3: 77
4: 727
Right 1051357639 9:16254391-16254413 CCAGGTTTTGAAATCTGGCAAGG No data
1051357632_1051357640 18 Left 1051357632 9:16254374-16254396 CCAGCTTCCCTTTCTCCCCAGGT 0: 1
1: 0
2: 9
3: 77
4: 727
Right 1051357640 9:16254415-16254437 GAATATTAAACCATGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051357632 Original CRISPR ACCTGGGGAGAAAGGGAAGC TGG (reversed) Intronic
900355412 1:2259700-2259722 GCCTGGGGAGAAAGGGGTGTGGG - Intronic
900837324 1:5015078-5015100 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
901827216 1:11870038-11870060 TCCTGGGGAGAACTGGAGGCTGG - Intergenic
902679801 1:18035100-18035122 ACTCGGGGAGAATGGGAAGCTGG + Intergenic
902918420 1:19652489-19652511 CACTGGGGAGGAAGGGCAGCTGG - Intronic
903354316 1:22736874-22736896 ACCTGGGGAGGAGGGGAGACTGG + Intronic
903535288 1:24062780-24062802 ACTGGGGGAGAAAGGGATGCAGG - Intronic
903651177 1:24923281-24923303 ACCTCGGGAGACAGGGAGCCTGG + Intronic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
903946468 1:26967020-26967042 CCCAGGGAAGGAAGGGAAGCAGG - Intergenic
904007412 1:27370729-27370751 ACCTGGAAAGAAGGGGAGGCAGG + Exonic
904079569 1:27863507-27863529 ACCTGGAGAGGAAAGGAAGAAGG - Intergenic
904289430 1:29474680-29474702 AGGAGGGGAGAAAGGGTAGCAGG + Intergenic
904866208 1:33580898-33580920 ACCTGGGGTGAGAAGGACGCAGG + Exonic
905030203 1:34877201-34877223 ACCTGCGCAGCAAGGGGAGCTGG + Intronic
905191671 1:36240211-36240233 AGCTGGGGAAAGAGAGAAGCTGG + Intronic
905230862 1:36514309-36514331 ACCTGAGGTGGGAGGGAAGCTGG + Intergenic
905808528 1:40894521-40894543 TCCTGGGGAGAAATTCAAGCTGG - Intergenic
906104294 1:43282803-43282825 AGCTGGGGACAGAGGGTAGCAGG - Exonic
906115815 1:43356484-43356506 AAATAGGGAGAACGGGAAGCCGG - Intergenic
906566372 1:46804017-46804039 ACCTCAGGAGAAAGGTAAACTGG + Intronic
907675705 1:56515990-56516012 ACCAGGGCAGAAAGGTAACCTGG - Intronic
908032846 1:60020004-60020026 TTCTGGGGAGAAAGTCAAGCTGG + Intronic
908302708 1:62778205-62778227 CCTTGGGGAGAAAGGCAAACCGG - Intergenic
908730065 1:67216940-67216962 ACTTGGGCAGAAAGGGGAGGAGG + Intronic
908746903 1:67384583-67384605 TTCTGGGGAGAAAGTCAAGCTGG - Intronic
908776261 1:67643347-67643369 ACATGGAGAGAAAGGGAACCTGG + Intergenic
909894020 1:81043247-81043269 AACTGGGCAGAAGGAGAAGCTGG - Intergenic
910497401 1:87847060-87847082 AGCTGAGGAGTAAGGCAAGCCGG - Intergenic
911001755 1:93173055-93173077 ACTTGGGGAGAGAGGGAATAGGG + Intronic
911150113 1:94590342-94590364 CCCTGGGGAGAGAGGGAGGGCGG - Intergenic
911624418 1:100104760-100104782 ACCTGAGAAAAAAGGGAGGCTGG - Intronic
911797773 1:102095781-102095803 AGCTGCAGAGAAAGGGAACCTGG + Intergenic
911848495 1:102784273-102784295 TCCTGGGGAGAAATTCAAGCAGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913454555 1:119018039-119018061 ATCTGAAGAAAAAGGGAAGCAGG + Intergenic
913690320 1:121273560-121273582 GAATGGGGAGAAAGGGAAGGAGG + Intronic
914147222 1:145006399-145006421 GAATGGGGAGAAAGGGAAGGAGG - Intronic
914716782 1:150260421-150260443 AGCTGGGGTGGAAAGGAAGCTGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915896531 1:159815446-159815468 CCGTGGGGAGAAAGGTGAGCTGG + Exonic
916011607 1:160711439-160711461 ACCTGGGGAGCAAGAGAAGTAGG - Intronic
916058635 1:161084631-161084653 ACCTGAGGAGCAAGGGGAGAGGG - Intronic
916301749 1:163283134-163283156 AAATGGGGAGAAAGGAAAGGGGG + Intronic
916987470 1:170207280-170207302 TTCTGGGGAGAAATTGAAGCTGG + Intergenic
918078096 1:181185644-181185666 ACCTGGGAAGATGGGGAAGGTGG - Intergenic
918343315 1:183584991-183585013 ATCTGGGGAGAAAGAGAGCCTGG - Intronic
918560983 1:185867330-185867352 ACCTGGGAAGAAAGGGATTGGGG + Intronic
918657476 1:187046249-187046271 AGCTGGGGAAAGAGAGAAGCTGG + Intergenic
919776915 1:201200216-201200238 CCCTGGGGAGCAAGGCTAGCAGG - Exonic
920032863 1:203048045-203048067 ACCTGGGAAGAAAGGCAATGGGG + Intronic
920090316 1:203448255-203448277 ATCTGGGGAGAAAGGGAGACAGG + Intergenic
920191211 1:204195046-204195068 ACTCGGGGGGAAAGGGGAGCCGG - Intronic
920477640 1:206292048-206292070 GAATGGGGAGAAAGGGAAGGAGG + Intronic
920529155 1:206689233-206689255 ACCTAGGGAGAGAGGAATGCTGG - Intronic
920914956 1:210251962-210251984 TCCTGGGGCGGAAGGGAAGAGGG - Intergenic
920942869 1:210500639-210500661 ACCTGGGCAGAAAGATCAGCAGG + Intronic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
921294464 1:213688976-213688998 AGAAGGGGAGAAAGGGAGGCTGG + Intergenic
922238037 1:223736217-223736239 CCCTGGGCAGGAAGGGAGGCAGG + Intronic
923058557 1:230448966-230448988 ATCTAGGGAGAATGGGAACCAGG - Intergenic
924071387 1:240283861-240283883 ACCTGGAAGGAAAGGGAAACTGG - Intronic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
924483169 1:244454567-244454589 AACTGCAGAGAAAGGGAACCCGG + Intronic
924597928 1:245463467-245463489 TCCTGGTGGGAAAGGGCAGCTGG + Intronic
924663666 1:246047458-246047480 ACCTGTGGAAAAAAGAAAGCTGG + Intronic
1064136877 10:12758694-12758716 ACCTTGACAGAATGGGAAGCAGG + Intronic
1064218960 10:13423506-13423528 AACTCAGCAGAAAGGGAAGCCGG + Intergenic
1064538603 10:16383648-16383670 AACTGGGAAGAAAGGGAATGTGG + Intergenic
1065173288 10:23053087-23053109 TCTCTGGGAGAAAGGGAAGCGGG - Intergenic
1065203037 10:23331596-23331618 ACCTGGAGAGAAGGGGAACCGGG + Intronic
1065266215 10:23978974-23978996 ACCTGGGAAGCAAAGTAAGCTGG + Intronic
1065590782 10:27259169-27259191 CCCGGGAGGGAAAGGGAAGCAGG - Intergenic
1065608386 10:27445195-27445217 AGCTGGGGAGAGAGAAAAGCTGG + Intergenic
1066267298 10:33788696-33788718 ACCAAGGGAGCCAGGGAAGCGGG + Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1068731827 10:60366630-60366652 GCTTGGGGAGGAAGGGAAGGAGG + Intronic
1068769908 10:60809558-60809580 TCCTGGGGACAAAGGTAGGCTGG + Intergenic
1069552926 10:69376913-69376935 ACCTGTGGAGAAAGGCACACCGG - Exonic
1069783613 10:70974048-70974070 ACTTGGGGAGAAAGGGTAGGGGG + Intergenic
1069996353 10:72344397-72344419 ACCTGGGGAGAAATGGGAGCTGG + Intronic
1070348279 10:75566749-75566771 ACCTTGGGAGAAAGAGAAAGTGG - Intronic
1070986925 10:80697137-80697159 TCCTGGGCAGAGAGGGAACCAGG - Intergenic
1071391786 10:85182726-85182748 ACCTTGGGAGAAAGGATTGCAGG - Intergenic
1072913250 10:99521862-99521884 GCCTGGAGGGAAAGGGGAGCGGG - Intergenic
1073101354 10:101008411-101008433 TCCTGGGGATAACGGGATGCTGG + Intronic
1073105164 10:101028752-101028774 ACATTGGGGAAAAGGGAAGCAGG - Intronic
1073481286 10:103787610-103787632 CCCTGGGGAGCAAGGCAGGCTGG + Intronic
1073855109 10:107664441-107664463 AGCTGAGGAGGAAGGGGAGCTGG - Intergenic
1074424973 10:113342725-113342747 ACCTGGGCAGATAGGGAGCCAGG + Intergenic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1074883766 10:117679006-117679028 ACCTGGGGAGAGTGGCAACCAGG - Intergenic
1075261650 10:120968509-120968531 CACTGGGGAGGAAGGAAAGCTGG - Intergenic
1076175612 10:128365619-128365641 TCCTGTGGAGGAAGGGAAGGTGG - Intergenic
1076183935 10:128431913-128431935 ACCTGTGGAAAATGGGGAGCAGG + Intergenic
1076293015 10:129362040-129362062 ACCTGGGGAGAGAAGGAGGCAGG + Intergenic
1076481648 10:130788959-130788981 AGCAGGGGAGCAGGGGAAGCAGG + Intergenic
1076481657 10:130788984-130789006 AGCAGGGGAGCAGGGGAAGCAGG + Intergenic
1076738108 10:132467691-132467713 GCCTGGGGAGACTGGGCAGCAGG - Intergenic
1076738284 10:132468381-132468403 ACCAAGGGAGAGAGGGAAGAAGG + Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077341472 11:2028245-2028267 TCATGGGCAGAAAGGGGAGCTGG - Intergenic
1077373106 11:2192819-2192841 AACAGGGGAGAAAGGGAGGGAGG - Intergenic
1077671882 11:4165271-4165293 AGCTGGGGAGGAAGGGACCCTGG + Intergenic
1077926662 11:6687960-6687982 AGCTGCAGAGAAAGGGAACCTGG + Intergenic
1078652422 11:13207988-13208010 ACTCGGGGAGAGAGGGAAGTCGG - Intergenic
1078923240 11:15850949-15850971 ACAGAGAGAGAAAGGGAAGCAGG - Intergenic
1079099712 11:17533553-17533575 ACCTGGGGACAAAGGGTGCCTGG - Intronic
1079109910 11:17599568-17599590 ACTTGGGGAAGAAGGGAGGCTGG + Intronic
1079318317 11:19429013-19429035 ACCTGGGGAGAAGGGGAATGGGG + Intronic
1080266478 11:30407069-30407091 AAGTAGGGAGAAACGGAAGCTGG - Intronic
1081657808 11:44868778-44868800 ACCAGGGCAGAAAGTGAGGCAGG + Intronic
1081752925 11:45524863-45524885 GCCAGGGGAGACAGTGAAGCTGG - Intergenic
1082006124 11:47420100-47420122 AACTGAGGAGAAACGGAGGCTGG + Intronic
1083248372 11:61448163-61448185 CCCTGGGGAGAATGTTAAGCAGG + Intronic
1083462742 11:62825395-62825417 ACCTGGGGAGGAAGGGAGGGAGG - Intronic
1083503954 11:63137832-63137854 AGCTGCAGAGAAAGGGAAACTGG + Intronic
1083605871 11:63978611-63978633 AGAGGAGGAGAAAGGGAAGCTGG - Intronic
1083823152 11:65183603-65183625 CCCTGGGGAGGAGGGGCAGCAGG + Intronic
1083911712 11:65713647-65713669 ACCTGGGGAAAAACCGAGGCCGG - Exonic
1083974581 11:66107374-66107396 TGCTATGGAGAAAGGGAAGCAGG - Intronic
1084055162 11:66627240-66627262 ACTTGGGGAGATGGGGAAGTGGG - Exonic
1084152900 11:67299509-67299531 ACCTGGGGAGCAGGGGACACGGG - Exonic
1084500097 11:69530324-69530346 ACCTGGGGAGGAGGGAAAGAAGG + Intergenic
1084739476 11:71129985-71130007 ACCTGGGGACACAGAGAAGGTGG - Intronic
1084871722 11:72103093-72103115 ACCTGCGGAGGACGGGCAGCCGG - Intronic
1086748334 11:90457719-90457741 GACTGGGGAGAGAGGGAAGTGGG + Intergenic
1087134769 11:94705561-94705583 AGCCTGGGAGAAAGGGCAGCTGG + Intergenic
1088594321 11:111428548-111428570 ACCTGGGGAGAAAAACAATCAGG + Intronic
1088611119 11:111578061-111578083 ATCAGGGCAGAAGGGGAAGCAGG - Intergenic
1089158958 11:116423326-116423348 ACCTGGGGAAAACAAGAAGCAGG + Intergenic
1089340448 11:117753929-117753951 TCCTGGGGACAAGGTGAAGCAGG + Intronic
1089489513 11:118873126-118873148 GCCTGTGGAGACAGGCAAGCAGG - Intergenic
1089497352 11:118914397-118914419 ACCTGGGGAGAGAGCAGAGCAGG - Intronic
1089701345 11:120245941-120245963 ACCTGGGAAGAAAGGTGAGAAGG + Intronic
1090239085 11:125169435-125169457 ACCTGGTGGGAAAGGGAGGAAGG + Intronic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1090830694 11:130419009-130419031 CCCTGGGGAGGAAGGGAGACAGG - Intronic
1090859520 11:130640521-130640543 TCCAGGGGAGAAATGGCAGCTGG + Intergenic
1091204298 11:133809097-133809119 AGCTGGGGAGAAAGTGAAGACGG - Intergenic
1091347696 11:134866359-134866381 TCCTGGCGAGAGGGGGAAGCAGG - Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1202824458 11_KI270721v1_random:83434-83456 TCATGGGCAGAAAGGGGAGCTGG - Intergenic
1091741040 12:2960219-2960241 ACTTTGGGGGAAAGGGAGGCCGG + Intronic
1092258768 12:6941394-6941416 ATCGGGGCAGAAAGGGAGGCCGG - Exonic
1092729266 12:11512974-11512996 ACTTGGGGAGAGTGGGATGCCGG + Intergenic
1093029167 12:14272196-14272218 ACCTGAGGGGAAGAGGAAGCTGG + Intergenic
1093036028 12:14333307-14333329 ACCTAGGGAGATTGGGATGCTGG + Intergenic
1093452404 12:19331614-19331636 TGCGGGGGAGAAAGTGAAGCAGG - Intronic
1095862617 12:46934837-46934859 ACCTATGTACAAAGGGAAGCAGG + Intergenic
1096190471 12:49614562-49614584 CACTGGGGAGTACGGGAAGCAGG + Intronic
1096191402 12:49622616-49622638 ACCTGGGAGGAAAAGGAAGTGGG - Intronic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1096419154 12:51441464-51441486 CCCAGGGGAAAAAGGAAAGCAGG - Intronic
1096424185 12:51487136-51487158 GACAGGGGAGAAAGGGAAACGGG + Intronic
1096671879 12:53204558-53204580 AGCTTGGGAGAAGGGGAAGTGGG + Intronic
1096976954 12:55704839-55704861 CCCTGGGCAGAAAAGGAAACGGG + Intronic
1097170766 12:57111375-57111397 ACCTGGGTAGAAGGAGAAGCCGG - Exonic
1097879113 12:64671178-64671200 ACCAGGAAAGAAAGGGAGGCAGG + Intronic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1098381959 12:69879174-69879196 ACCTGGGGAGAGACACAAGCAGG - Intronic
1098480609 12:70954947-70954969 AGATGAGGAGAAAGGGAAGGTGG + Intergenic
1098837658 12:75441658-75441680 TTCTGGGGAGAAATTGAAGCTGG + Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1100284668 12:93153762-93153784 TCCTTGGAAGTAAGGGAAGCAGG - Intergenic
1101312766 12:103598741-103598763 AACTTGGGAGAAAAGGTAGCAGG - Intronic
1101526254 12:105534078-105534100 ATCATGGCAGAAAGGGAAGCAGG + Intergenic
1102370023 12:112375084-112375106 ACCTGGGGATAGAGGCAGGCAGG - Intronic
1102507411 12:113392385-113392407 ACTTGGGGTGGAAGGAAAGCAGG + Intergenic
1102588619 12:113940722-113940744 CTCTGGTGAGAAAGGGATGCAGG - Intronic
1102731471 12:115114731-115114753 AACTGGGGAGAAAGGGAATCAGG - Intergenic
1103216773 12:119207773-119207795 ATTTGGGGAGAAAGGGATGTGGG - Intronic
1103388380 12:120551948-120551970 ACAGCGGGAGAACGGGAAGCAGG + Intronic
1103410198 12:120705960-120705982 AGCTGGGGGGAAAGGAAGGCTGG + Intergenic
1103933165 12:124461121-124461143 ACCTGGGGGAGAAGGGAAACAGG + Intronic
1103952264 12:124557768-124557790 ACCAGGGGAGGAAGGCAAGCGGG - Intronic
1104012384 12:124940835-124940857 ACGTGGGGAGATCGGGAAGGAGG + Intergenic
1104109041 12:125688672-125688694 ACCTGGGGACTATGGGAAGTGGG - Intergenic
1104841808 12:131829213-131829235 ACCTGGGGTGGAGGGGAAGGAGG - Intronic
1104842649 12:131832158-131832180 ATCTGGGGGGGAAGGGAAGGGGG + Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1105313592 13:19235992-19236014 AGCATGGGACAAAGGGAAGCTGG - Intergenic
1105812543 13:24007965-24007987 TCCTGGGGGGAAATGGAGGCAGG + Intronic
1106319061 13:28621668-28621690 AACTGGGAAAAAAGGGAAGGAGG - Intergenic
1106479166 13:30123887-30123909 TCCTGGGGAGAGAAGGCAGCTGG + Intergenic
1106614389 13:31313691-31313713 TTCTGGGGAGAAAGTCAAGCCGG + Intronic
1107128768 13:36872695-36872717 TCCTGGGGAGTGAGGGTAGCTGG + Exonic
1107577592 13:41744026-41744048 CCTGAGGGAGAAAGGGAAGCAGG - Intronic
1107687550 13:42918920-42918942 ACCTAGTGAGGAAGGGAAGAAGG + Intronic
1109469798 13:62790351-62790373 AGCTGCAGAGAAAGGGAACCCGG - Intergenic
1109736621 13:66494133-66494155 ACCTGAGTAGAAAAGGAATCTGG + Intronic
1109967166 13:69715416-69715438 ATCATGGGAGAAGGGGAAGCGGG - Intronic
1110040741 13:70754403-70754425 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1110187763 13:72694588-72694610 ACCTGGGAAGAATGTGTAGCAGG - Intergenic
1111189378 13:84788825-84788847 AGCTGCAGAGAAAGGGAACCTGG + Intergenic
1112081026 13:95970949-95970971 GACTGGGGAGAAAGGCAAGTAGG - Intronic
1112248256 13:97754163-97754185 ACTGGGGGAGGAAGGGCAGCAGG - Intergenic
1112559821 13:100503003-100503025 TCCTGGGGAGGAGGGGAGGCTGG + Intronic
1112614170 13:100986171-100986193 ACCTGGGGAACCAGGAAAGCTGG - Intergenic
1112855876 13:103768804-103768826 TCCTGGGGAGAAATTCAAGCAGG - Intergenic
1113379115 13:109786763-109786785 GCCCGGGGAGAAAGGGGGGCGGG - Intergenic
1113414371 13:110116886-110116908 GGCTGGGCAGAAAGGGCAGCAGG + Intergenic
1113443524 13:110347796-110347818 GCCTGAGGAGAAATGGAAGGTGG + Intronic
1113744334 13:112732407-112732429 AGCTGGAGAGAGAGGGAAGCAGG - Intronic
1113791137 13:113029032-113029054 ACCTGGGAAGAAAGGAAACGTGG - Intronic
1114141637 14:19918095-19918117 AACTGGGGGGAAAGTGTAGCTGG + Intergenic
1115730271 14:36260956-36260978 ATGTGGGGAGAAATGGAAGGTGG + Intergenic
1115886164 14:37974238-37974260 ACCTGAGGAGCAAAGGAGGCTGG + Intronic
1115968275 14:38916176-38916198 TCCTGAGGAGAAATTGAAGCTGG - Intergenic
1116184520 14:41580140-41580162 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1117200827 14:53388372-53388394 ACCTAGGGAGAAAGCACAGCTGG - Intergenic
1117461818 14:55952865-55952887 ACCTGCAGAGAAGGGGCAGCTGG + Intergenic
1117547012 14:56801880-56801902 CCCTGGGTGGAAAGAGAAGCTGG + Exonic
1117978768 14:61321902-61321924 ACCTCGGGAGGGAGGGAAGGAGG + Exonic
1118160615 14:63286184-63286206 ACCAAGGGAGAAAGGGAAAATGG - Intronic
1119527456 14:75333842-75333864 ACCTGGGGAGGAGGGGAGGGGGG + Intergenic
1120628092 14:86854586-86854608 ACATGGGGAGAAAGAGCATCAGG - Intergenic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121084828 14:91137842-91137864 GCCTTGGGAGAGAGGGGAGCAGG + Intronic
1121178665 14:91910776-91910798 TGCTGGGGAGAAAGGGATGGCGG + Intronic
1121421356 14:93817990-93818012 ACCAGCAGAGAGAGGGAAGCAGG - Intergenic
1121485715 14:94312833-94312855 AGCTGGGGAGGAGGGGAAGGGGG + Intronic
1121722369 14:96118607-96118629 AGCTGGGAAGACAGGGAAGAAGG - Intergenic
1122120418 14:99550373-99550395 AGCTGGACAGACAGGGAAGCGGG + Intronic
1122596836 14:102899582-102899604 AGCTGGCCAGGAAGGGAAGCAGG - Intronic
1122628593 14:103097267-103097289 ACCTGGGGAGAGTGGGACCCGGG + Intergenic
1123158263 14:106251766-106251788 TCCTGGGGAGAAATTCAAGCTGG + Intergenic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1123872575 15:24592012-24592034 AGCTGCAGAGAAAGGGAACCTGG - Intergenic
1124421575 15:29527593-29527615 CCCTGGGGAGGAAGTGAGGCAGG - Intronic
1124627739 15:31318637-31318659 ACCCTGGGAGAAAGGGAGGACGG + Intergenic
1125141336 15:36411247-36411269 ACCTGGGGAGGGAGGGAAAGGGG - Intergenic
1125618131 15:41034333-41034355 CCCTGGGGAGTAAGAGAAGAAGG + Intronic
1125662483 15:41405047-41405069 ACCAGTGGAGAAAGGAAGGCTGG + Intergenic
1125806232 15:42495906-42495928 ACCAGTGGAGGAAGGGTAGCTGG + Intronic
1125991552 15:44113689-44113711 AAGTGGGGAGGAGGGGAAGCGGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128226401 15:66004351-66004373 CCCTGGGGAGAAAGAGAGGGAGG + Intronic
1128262144 15:66239995-66240017 ACTTCGGGAGAAAAGAAAGCTGG - Intronic
1128690993 15:69724865-69724887 TCCTGGGGAGCATGGGAAGAAGG + Intergenic
1128899739 15:71409375-71409397 AGCTGGGGAGAGAGGGAATGGGG + Intronic
1129383143 15:75180508-75180530 TCCTGTGGAGGAGGGGAAGCAGG - Intergenic
1130632318 15:85581533-85581555 TGATTGGGAGAAAGGGAAGCTGG + Exonic
1131365404 15:91834836-91834858 GCCTGGGCAGAAATGCAAGCAGG + Intergenic
1131610992 15:93963607-93963629 ACCTGGGGAGCTAAAGAAGCAGG - Intergenic
1131630401 15:94170269-94170291 ACCTGAGGATAAAGGGCAGAAGG + Intergenic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1131988177 15:98065946-98065968 ACTTGGGCAGAAAGGGAGGAGGG - Intergenic
1132141865 15:99403621-99403643 GGCTGGGGAGAAAGGAGAGCTGG - Intergenic
1132871555 16:2117754-2117776 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1132988957 16:2783350-2783372 TCCTGGGGAGCCAGGGAAGTGGG - Intergenic
1133030444 16:3008389-3008411 ACCCTGGGAGGAAAGGAAGCCGG - Intergenic
1133052280 16:3124083-3124105 ACCTGGGGCCGCAGGGAAGCAGG - Intergenic
1133175967 16:4014839-4014861 ACTGGGAGAGAGAGGGAAGCTGG - Intronic
1133398039 16:5464136-5464158 AGCTGGGGAGAGAGGAGAGCTGG + Intergenic
1133668263 16:7992417-7992439 ACATGGAGAGAAAGAGAAGGAGG + Intergenic
1134332034 16:13259960-13259982 TTCTGGGGAGAAATGCAAGCTGG - Intergenic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1134520974 16:14919141-14919163 CCCTGGGGAGGAAGGGGAGTGGG - Intronic
1134550598 16:15136832-15136854 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1134708650 16:16317792-16317814 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134715863 16:16357825-16357847 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134845041 16:17433051-17433073 CCCTGAGGAGAATGGGAATCAGG + Intronic
1134950954 16:18350853-18350875 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134958893 16:18394334-18394356 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1135382223 16:22004698-22004720 TCCTATGGGGAAAGGGAAGCAGG - Intergenic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1140024047 16:71267470-71267492 AACAGGGGAGATAGGGAAGAAGG - Intergenic
1140408504 16:74726769-74726791 ACCTGGGGTCAAAGGGACACTGG + Intronic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1140723640 16:77792438-77792460 ACTATGGGAGCAAGGGAAGCAGG + Intronic
1140731865 16:77863761-77863783 ACCTGGGGGGAAAGGGAAGAAGG + Intronic
1140740332 16:77936038-77936060 ACCTGGGGAGAAAAAAAAGGAGG + Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141212817 16:81996769-81996791 AATTGGGGAGATATGGAAGCAGG + Exonic
1141220493 16:82065067-82065089 CCCTGTGGGGAAGGGGAAGCTGG + Intronic
1141509810 16:84504938-84504960 ACCTGGGGAGAAGGGGTGTCTGG + Intronic
1142253507 16:89003076-89003098 ACCTGGGGGGACAGAGGAGCCGG + Intergenic
1142406306 16:89892172-89892194 GCCTGGGGAGAACGGGACACAGG - Exonic
1142690709 17:1604879-1604901 ACCGGTGGAGGCAGGGAAGCTGG - Intronic
1142701004 17:1660826-1660848 CCCTGGGGAGCAAGAGAAGCAGG + Exonic
1142946828 17:3436559-3436581 ATTTGGGGAGAAAGGGAACGAGG + Intergenic
1142959396 17:3543126-3543148 ACCTGGGGAGTGAGGGACGGGGG - Intronic
1143274440 17:5699776-5699798 TCCTGGGGGAAAAGGGAAGGGGG + Intergenic
1143581968 17:7833050-7833072 TCCTGGGGAGAAATGGGAGCAGG - Exonic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1143889235 17:10089700-10089722 ACTTGGGGAGAAAGGTAAGGAGG + Intronic
1143956420 17:10673578-10673600 GCCTGGGCTGACAGGGAAGCAGG + Exonic
1143960559 17:10714530-10714552 TCTTGGAAAGAAAGGGAAGCTGG - Exonic
1144726218 17:17503979-17504001 GGCTGGGGAGACAGGGAAGGAGG + Intergenic
1145014016 17:19385280-19385302 CCCTGGGGAGGAGGGGCAGCTGG + Exonic
1146487399 17:33254517-33254539 ACCTGGGGGTAAGAGGAAGCTGG - Intronic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1147533441 17:41301684-41301706 ACCTGGAGAGAATGTGAAGGTGG + Intergenic
1147694319 17:42339810-42339832 TCTTGGGGAGAAGGGGAGGCTGG + Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147931330 17:43983444-43983466 TCCTGCTGAGAACGGGAAGCTGG + Intronic
1148091444 17:45024755-45024777 ACTTGGGGTGAGAGGGAGGCAGG - Intronic
1148128546 17:45248855-45248877 ACCTGGGGAGAGAGGAGAGGGGG + Intergenic
1148538699 17:48462510-48462532 ACCTGATGGGAAAGGGAGGCAGG + Intergenic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1148788156 17:50156293-50156315 AACTGGGGAGAAAGAAAAGGGGG - Intergenic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1149446729 17:56718974-56718996 ACCTGGGGAGAGACTGAAGGAGG + Intergenic
1149615972 17:57998991-57999013 ACCTGGGGAGAAAGCGGTGATGG + Intronic
1150105429 17:62459297-62459319 TCCTGGGGTGAAGGGGGAGCTGG + Intronic
1151598437 17:75091715-75091737 ACCTGGGGTGAAAGGGAGGGAGG + Intronic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1153243815 18:3054333-3054355 ACAAGGTCAGAAAGGGAAGCAGG - Intergenic
1153343369 18:4000276-4000298 AACAGGGGAGAAAGTGAAGAAGG - Intronic
1153350401 18:4074599-4074621 ACCTGGGTAGAAAAGGCAGTTGG - Intronic
1153688008 18:7566470-7566492 AACAGGGGAGAAAGAGAAGTGGG - Intergenic
1153706541 18:7751153-7751175 ATCAGGGCAGAAAGGTAAGCTGG - Intronic
1153763725 18:8355438-8355460 ACCAGGGGAGATAGGGAATGGGG + Intronic
1154087670 18:11323006-11323028 ACTTGAGGAGATAGAGAAGCTGG - Intergenic
1155717345 18:28961456-28961478 ACATGTTGAGCAAGGGAAGCAGG - Intergenic
1156078373 18:33307553-33307575 TTCTGGGGAGAAATGCAAGCTGG + Intronic
1156277133 18:35594152-35594174 ACCTTGGGAGAAAGGGCTGATGG + Intronic
1156351939 18:36309370-36309392 ACCTGGGGAGAAAGGAGTGGTGG + Intronic
1156384210 18:36591399-36591421 ACGAGGTGAGAAAGGGAGGCTGG + Intronic
1156455009 18:37288072-37288094 ACCTGTGTTGAAAGAGAAGCTGG - Intronic
1156460399 18:37318455-37318477 TTCTGGGGAGAAGGGGAAGGGGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157865652 18:51181751-51181773 ACCTAGGGGGACAGGGAAGGAGG + Intronic
1157904884 18:51560800-51560822 ACCTGGGGAGAAAAGCAGGATGG + Intergenic
1158514371 18:58119178-58119200 AGATGGGGACAAAGGGAAGGTGG - Intronic
1159539736 18:69760478-69760500 ACCTTGGGAGAGAGCAAAGCAGG + Intronic
1159539743 18:69760531-69760553 ACCTTGGGAGAAAGCAAAGCAGG + Intronic
1159658459 18:71061894-71061916 CCATAGGGAGAAAGGAAAGCTGG - Intergenic
1160295917 18:77636980-77637002 ACCCGGGGAAAAAGGAAAACAGG + Intergenic
1160300348 18:77672409-77672431 GCCTGGGGAGACGGGGGAGCGGG + Intergenic
1160495111 18:79368896-79368918 GCCTTGGCAGGAAGGGAAGCTGG - Intronic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1160901869 19:1432792-1432814 ACCTGGTGGGAAAGGGGAGAGGG + Intronic
1161349647 19:3784788-3784810 ACCCGGGGAGCAGAGGAAGCAGG + Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161758903 19:6156290-6156312 AGTTGGGGAGGAAGGGAAGCTGG + Intronic
1161913940 19:7214944-7214966 AGCTGGGAAGACAGGGAAGAAGG - Intronic
1162187941 19:8921861-8921883 CCCTGGGAAGGAAAGGAAGCTGG + Intronic
1162306774 19:9879508-9879530 GCAGGGGGTGAAAGGGAAGCAGG - Intronic
1163491892 19:17621733-17621755 ACCTGGGCAGGAAGGGCAGCTGG - Intronic
1163537552 19:17885736-17885758 AGCTGGGGAGAGGGGGAAGTGGG - Intronic
1163665699 19:18603253-18603275 ACTAGGGGAGAAAGTAAAGCAGG + Intronic
1164501086 19:28820852-28820874 GCCTGGGGAGCAAAGGAAGCTGG - Intergenic
1164554842 19:29243486-29243508 GCCAGGGGTGAAAGGGAAGCAGG + Intergenic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165774196 19:38395353-38395375 ACCTTGGGAGAGAAGCAAGCTGG + Intronic
1165888755 19:39098437-39098459 ACCTGGGGAGAAAGGGACAGAGG - Exonic
1166360402 19:42250753-42250775 AGCTGGGGGGGAGGGGAAGCTGG + Intronic
1167426031 19:49430158-49430180 CCCTGGAGATAAAGGAAAGCGGG + Exonic
1167579086 19:50331534-50331556 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579098 19:50331574-50331596 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167579110 19:50331614-50331636 AGATGGGGAGAAGGGGAAGAAGG - Intronic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167887716 19:52515935-52515957 TCCTGGGGAACACGGGAAGCCGG - Intergenic
1167904098 19:52644032-52644054 TCCTGGGGAACACGGGAAGCTGG + Intronic
1167908847 19:52684918-52684940 TCCTGGGGAACACGGGAAGCCGG + Intronic
1167910924 19:52700990-52701012 TCCTGGGGAACACGGGAAGCTGG + Intergenic
1167918581 19:52762260-52762282 TCCTGGGGAACACGGGAAGCCGG + Intergenic
1167925648 19:52819247-52819269 TCCTGGGGAACACGGGAAGCAGG + Intronic
1167929891 19:52855536-52855558 TCCTGGGGAACACGGGAAGCAGG + Intronic
1167934023 19:52891712-52891734 TCCTGGGGAACACGGGAAGCTGG + Intronic
1167960293 19:53099478-53099500 TCCTGGGGAACACGGGAAGCCGG + Intronic
1167992312 19:53370831-53370853 TCCTGGGGAACACGGGAAGCCGG - Intronic
1168005337 19:53482338-53482360 TCCTGGGGAACACGGGAAGCTGG - Intronic
1168304278 19:55426662-55426684 ACTGGGTGGGAAAGGGAAGCAGG + Intergenic
1168316901 19:55488502-55488524 AGCTGGGGAGAGAGGGAGGGAGG - Intronic
1168351172 19:55676806-55676828 ACATGGGAAGACAGGGAGGCAGG - Exonic
1168388642 19:55987683-55987705 ACCTGGGTAGAAAGGTGAGGTGG + Intronic
1168474704 19:56667484-56667506 CCCTCGGGAGAAGGGGAGGCTGG - Intronic
925294777 2:2769289-2769311 ACCTGGAGAGAAAGGGGACCTGG - Intergenic
925824831 2:7837492-7837514 GCCTGGGGAGAGTGGGAAGCTGG - Intergenic
925928138 2:8685246-8685268 ACCGGGGGAGGAAGGGATCCGGG + Intergenic
926092841 2:10061635-10061657 TCTTGGGGAGAAAGGAGAGCAGG + Intronic
926400725 2:12493312-12493334 ACCTGGTGTGACAGGGAAGGAGG - Intergenic
926952070 2:18253830-18253852 ACCTGAGGAGAAATTCAAGCTGG + Intronic
927168751 2:20350874-20350896 ACCCCGGGAGAAAGGGGAGGGGG + Intronic
927631409 2:24777381-24777403 ACATGGTGACAAAGGGAAGCTGG + Intergenic
928304622 2:30157394-30157416 ACATGTGGAGAAAGGGAGGTGGG - Intronic
928721435 2:34125847-34125869 ACCATGGGAGAAAGTGAAGGAGG + Intergenic
928980005 2:37127675-37127697 GCATGGAGAGAAATGGAAGCAGG - Intronic
929452272 2:42046128-42046150 CCCTGGGGAAAACGGGGAGCTGG - Intergenic
929530414 2:42747479-42747501 CCTTGGGGAGAAAGAGGAGCAGG + Intronic
929564665 2:42976845-42976867 ACCTGGGGAGAAGGGCAGGCTGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930607624 2:53508938-53508960 ATCATGGCAGAAAGGGAAGCAGG + Intergenic
930965167 2:57313987-57314009 AACTGGGAAGCCAGGGAAGCTGG - Intergenic
931209607 2:60179928-60179950 ACGTTTGGAGAAAGAGAAGCTGG + Intergenic
931329780 2:61268480-61268502 ACATGGCGAGAAAGGGAGGTGGG - Intronic
931724182 2:65092976-65092998 ACTGTGGCAGAAAGGGAAGCAGG - Intronic
931758483 2:65395363-65395385 CCCTGGAGAGAAGGGGAAGGGGG - Intronic
931799860 2:65748030-65748052 ACCCGGGGAGAAGGAGAAGAGGG - Intergenic
931882336 2:66580905-66580927 ACCCGGGGGGAAAGGGAGGGGGG - Intergenic
932977049 2:76615400-76615422 ACCTGGGGAAACAGCCAAGCTGG - Intergenic
933528293 2:83472540-83472562 ACATGGGCAGAAAAGGAGGCTGG + Intergenic
933763068 2:85687406-85687428 AGCTGGGGAGAAAGCGGAGAGGG + Intronic
933935424 2:87199738-87199760 TCTTTGGGTGAAAGGGAAGCTGG + Intergenic
934568221 2:95352386-95352408 GCCAGGGGAGGAAGGGTAGCTGG + Intronic
934659584 2:96136125-96136147 ACAGGGGGAGTGAGGGAAGCAGG + Intronic
934780178 2:96964950-96964972 ACCTGGGGAGAGAGAACAGCAGG - Intronic
934921728 2:98349184-98349206 ACCTGGCCTGAAAGGGAGGCTGG + Intronic
935353917 2:102180401-102180423 ACCTGGGGAGAAGGGGCAGGTGG + Intergenic
936357724 2:111766161-111766183 TCTTTGGGTGAAAGGGAAGCTGG - Intergenic
936383403 2:112007508-112007530 GGCTGGGGAGAAAGGGTAGTGGG - Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937852121 2:126644974-126644996 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
938401617 2:130997209-130997231 CCTTGTGGGGAAAGGGAAGCTGG - Intronic
939113095 2:138031050-138031072 ACCTGGTGAAAAATGGAATCAGG + Intergenic
939140352 2:138346717-138346739 ACCTGGGGAGAGAGTGTAGAGGG - Intergenic
939962195 2:148575238-148575260 GCCAGGGGAGAAATGGAGGCAGG + Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
940723768 2:157311187-157311209 ACCTGGAGAGAAAGAAGAGCTGG - Exonic
941400194 2:165021215-165021237 AGCTGGGGAAAGAGAGAAGCTGG + Intergenic
941528930 2:166640539-166640561 ACCTGGAAAGAGAGGAAAGCTGG - Intergenic
941695945 2:168550909-168550931 AAGTGGGGAGACAGGGAGGCTGG + Intronic
941739255 2:169015535-169015557 ACCTGGGGAGAAGGAGTAGCAGG - Intronic
941976356 2:171409556-171409578 AGTGGGGGAGAAAGGAAAGCTGG - Intronic
942588888 2:177518959-177518981 GCCTAGGGAGAAAGAAAAGCAGG + Intronic
943751309 2:191512428-191512450 CCCTGGAGAGAAAGCGCAGCTGG + Intergenic
944445045 2:199780603-199780625 ACCTAGGGACAAAGGGAACCTGG - Intronic
945240160 2:207669201-207669223 ACCTGATGAGAAGGGGAAGTGGG - Intergenic
945245417 2:207712336-207712358 GGCTTGGGAGAATGGGAAGCGGG - Intronic
945597728 2:211816053-211816075 AGCTGGGGAAAGAGAGAAGCTGG - Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946595951 2:221306175-221306197 AGATGGTGAGAAATGGAAGCAGG - Intergenic
947104044 2:226649861-226649883 GCCTGGAGAAAAAGGGAAGGAGG - Intergenic
947616114 2:231557796-231557818 TCCTGGGCAGGAAGGAAAGCCGG + Intergenic
947699179 2:232218106-232218128 CCTTGGGGAGAAAAAGAAGCGGG + Intronic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
947999253 2:234554142-234554164 AGCTGGAGAACAAGGGAAGCTGG - Intergenic
948129814 2:235592151-235592173 ACCTGGGGAGGGAGGGTGGCTGG + Intronic
948185842 2:236020679-236020701 AGCTGGGCACATAGGGAAGCTGG + Intronic
948347811 2:237313748-237313770 ACCTGGGGAGACTGAGTAGCAGG - Intergenic
948765342 2:240216557-240216579 ACCTGGGGAGCAGGGGGAGGTGG + Intergenic
948901819 2:240960128-240960150 ACCTGGGGCGAAGGGGAATTCGG + Intronic
1169143223 20:3237714-3237736 CCCTAGGGAGAAAGGGAAGCAGG + Intronic
1169261668 20:4143654-4143676 CCTTGGGGAGAAAAAGAAGCAGG - Intronic
1169910167 20:10641692-10641714 ACCTGGAGAAAAACAGAAGCTGG + Exonic
1170556654 20:17520220-17520242 ACCTGGGGTGAAAGGTGGGCGGG - Intronic
1171968573 20:31549128-31549150 ACCTGGGCAGAAGGGGAGGATGG + Intronic
1171990717 20:31694294-31694316 AGCTGGTGAGAAGGGGAAGAGGG + Intronic
1172021381 20:31916785-31916807 AGCTGGGGAGAAAGGGGATCGGG - Intronic
1172149533 20:32780276-32780298 GGGTGGGGTGAAAGGGAAGCAGG - Intronic
1172527062 20:35606287-35606309 GCCTGGGGAGACAGGGATGCAGG - Intergenic
1172950607 20:38721144-38721166 ACCTGGAGAGAAGGGGAGGGAGG - Intergenic
1173408249 20:42786117-42786139 ATCATGGCAGAAAGGGAAGCAGG - Intronic
1173492612 20:43495408-43495430 AGCTGGGGAAAAAGAGAAGGTGG + Intergenic
1173638734 20:44584021-44584043 ACTTGGGGAGAGAGGAAAGAAGG + Intronic
1173755512 20:45512203-45512225 ACCAGGGAAGAAAGGGGAGCTGG - Intergenic
1174137869 20:48393032-48393054 GCCTGGGGATAAAGGGGAGATGG + Intergenic
1174146305 20:48455036-48455058 ACGTGGGGAGGAAGGGAGGGAGG + Intergenic
1174427032 20:50439144-50439166 TCCTGGTGAGAAAGAGAACCGGG + Intergenic
1174582112 20:51579426-51579448 GCCTGGGGAGCAGAGGAAGCCGG + Intergenic
1175362153 20:58421025-58421047 ATCTGGGGAGAAGGGGAGGCTGG - Intronic
1175379797 20:58554907-58554929 TCCTGGTGAAAAAGTGAAGCTGG - Intergenic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175933877 20:62506252-62506274 ACCTGGGCAGTAGGGGAGGCTGG - Intergenic
1175973733 20:62699837-62699859 ACTTGGGGTGAAAGGGAGGGAGG + Intergenic
1176430914 21:6575125-6575147 ACCTTGAGAGAAAGGGCAGAAGG - Intergenic
1177774085 21:25549092-25549114 GTCTGGGGAGAGTGGGAAGCAGG - Intergenic
1178486968 21:33025576-33025598 ACCAAGGGAGAAAGGGAACGTGG - Intergenic
1179706308 21:43182587-43182609 ACCTTGAGAGAAAGGGCAGAAGG - Intergenic
1179902406 21:44401016-44401038 CCGTGAGGAGAAAGGGAAGGAGG - Intronic
1180179245 21:46110718-46110740 AGCTGGGCAGAAAGGGCACCGGG - Intronic
1180754681 22:18152752-18152774 CACTGGGGAGACAGGGAGGCGGG - Intronic
1181328335 22:22068881-22068903 ACCTGGGCAGCAAAGGAAGAGGG + Intergenic
1181425529 22:22835206-22835228 CCCTGAGGAGAAAGGGGAGGTGG - Intronic
1181429773 22:22872076-22872098 CCCTGAGGAGAAAGGGGAGGTGG - Intronic
1181539173 22:23564197-23564219 ATCTGGGGAGCCAGGAAAGCTGG + Intergenic
1182019150 22:27066368-27066390 ACCTGGAGAGAAAGGGGACTTGG + Intergenic
1182273413 22:29170036-29170058 AGCTGGGGAGAAGGGGTGGCTGG + Intergenic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1182519785 22:30878817-30878839 ACCTGGGGAGGAAGGGCACCCGG + Intronic
1182983482 22:34695016-34695038 ATCAGAGGAGAAAGAGAAGCTGG - Intergenic
1183290428 22:36998789-36998811 ACCTGGGAAGAAAGGAAGGGTGG - Intronic
1183387782 22:37525061-37525083 GCCATGGGAGAAAGGGAAGGTGG - Intergenic
1183417213 22:37689278-37689300 ACTGATGGAGAAAGGGAAGCAGG - Intronic
1183440537 22:37820559-37820581 ACCTGGGGAGCAAGGTACACTGG - Intergenic
1183654084 22:39175097-39175119 ACTTGGGGGGCTAGGGAAGCAGG + Intergenic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
1184310330 22:43637157-43637179 TTCTGGGGAGATAGGGAGGCAGG - Intronic
1184361453 22:44021380-44021402 ACTTGGGGAGAAAAAGGAGCAGG + Intronic
1184408478 22:44313383-44313405 GCCCGGGGAGGAAGGGTAGCTGG + Intergenic
1184652051 22:45923951-45923973 AGCTGGGGAGAAAGAACAGCGGG - Intronic
1184676452 22:46045696-46045718 GCCTGGGGAGGAGGAGAAGCTGG + Intergenic
1185330896 22:50251599-50251621 ACCTGGGGTGAAAGGCGAGGGGG + Intronic
1185382519 22:50516647-50516669 ACCTGAGGAGAGAGGGAGGTAGG - Intronic
1185428098 22:50784933-50784955 AGCTGGGGACAACTGGAAGCAGG + Intergenic
950952619 3:17016586-17016608 ACCAGGAGAGAAAGTGAGGCTGG + Intronic
951206575 3:19932089-19932111 ACGTGGTGAGTAAGGGAAGTTGG - Intronic
951246246 3:20344926-20344948 ATCATGGCAGAAAGGGAAGCAGG + Intergenic
951397518 3:22187854-22187876 ACCCTGGGAGAAAGGAAGGCTGG - Intronic
951920992 3:27853845-27853867 ATCATGGCAGAAAGGGAAGCAGG + Intergenic
952845967 3:37688594-37688616 GTCTGGGGAGAAAGGCAGGCAGG - Intronic
952865104 3:37849966-37849988 AGCTGGGAGGAAAGGGAAGGGGG + Intergenic
952998121 3:38904951-38904973 ACCTGGGTAGAGGTGGAAGCTGG - Intronic
953007856 3:38994780-38994802 ACCTGGAGACAGATGGAAGCTGG + Intergenic
953256612 3:41296866-41296888 ACCTGGAGAGGAAGGGGAGAGGG + Intronic
953278204 3:41525238-41525260 GCATGGTGAGAAAGGGAAGCAGG + Intronic
953668392 3:44942482-44942504 TCCTGGGGAGAGAGGCAAGGAGG + Intronic
953785578 3:45908628-45908650 AGCAGGGGAGAAAGGGGAGGAGG + Intronic
953847510 3:46439479-46439501 TCCTGGGGAGAAAAAGAAGGTGG + Exonic
954132225 3:48566659-48566681 TCCTGGCGAGAGAGGGGAGCAGG - Exonic
954133812 3:48572924-48572946 TCAGGGGGAGACAGGGAAGCCGG - Exonic
954407157 3:50351607-50351629 TCCTGGGGAGGAAGGGCAGTGGG + Intronic
954441033 3:50522055-50522077 GGCTGGGGAAAAAGGGAAGAGGG - Intergenic
954576780 3:51680713-51680735 ATCTGGGGAGGAAGAGGAGCAGG + Intronic
954708963 3:52495582-52495604 GCCTGGGGAGAAACCGCAGCTGG + Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955954092 3:64270349-64270371 GCCTTGGGACAAAGAGAAGCAGG + Intronic
956495205 3:69818231-69818253 AACAGGGGAAAAGGGGAAGCAGG - Intronic
957698179 3:83671597-83671619 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
958558435 3:95709757-95709779 AAATGGGGAAAAAGGGAAGTTGG + Intergenic
958604307 3:96338645-96338667 TTCTGGGGAGAAACTGAAGCCGG + Intergenic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
958813992 3:98895478-98895500 ACCTGGGGAGTCAGGAAAGTGGG - Intronic
958877586 3:99633535-99633557 AGCTGGGGAAAGAGAGAAGCAGG - Intergenic
959000931 3:100963653-100963675 ACCTGGAGAGAAAGAGAAACAGG - Intronic
959665606 3:108917586-108917608 CGCAGGAGAGAAAGGGAAGCAGG + Intronic
960586541 3:119325575-119325597 ACCAGGGGAGAAAGGGTGGAGGG + Intronic
960640031 3:119815419-119815441 ACCTGGGGAGAAGAGGGAGATGG - Exonic
960940130 3:122928002-122928024 ACCTGGGGACAATGGGGAGAAGG + Exonic
960945533 3:122963955-122963977 CCCTGGGGAGAGAGGGAGGGAGG - Intronic
961198464 3:125024334-125024356 ACCAGGGCACAAAGGGAAACCGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961736243 3:129003773-129003795 ACCTGCGGGGACAGGGCAGCAGG - Exonic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
962241511 3:133754658-133754680 ACCTCTTGAGAAAGGTAAGCTGG + Exonic
963018080 3:140844797-140844819 ACCATGGTAGAAGGGGAAGCAGG + Intergenic
963116659 3:141736132-141736154 GCATGGGGAGAAAGGAAAGCAGG - Intergenic
964385604 3:156144630-156144652 ACGTGGGGGGACAGAGAAGCAGG - Intronic
964427615 3:156569715-156569737 ATGAGGGGGGAAAGGGAAGCAGG + Intergenic
964808271 3:160635374-160635396 ACCTTGGAAGAATTGGAAGCAGG + Intergenic
965244391 3:166248870-166248892 TCCTGGGGAGAAATTCAAGCTGG + Intergenic
965353832 3:167649129-167649151 GCCTGGGTAGAAAGGCAAGAAGG + Intronic
965869396 3:173248598-173248620 AGCTGCAGAGAAAGGGAACCTGG - Intergenic
966235842 3:177700782-177700804 TCCTGGGGAGATAAGGAAGATGG - Intergenic
966402369 3:179561424-179561446 AGGTGGGGAAAAGGGGAAGCAGG - Intergenic
967013788 3:185463679-185463701 ACCTGGGGATGAAGGGAGGTGGG - Intronic
967290536 3:187915355-187915377 TCCAGGTAAGAAAGGGAAGCAGG - Intergenic
967634047 3:191779422-191779444 ACCATGGTGGAAAGGGAAGCAGG - Intergenic
968065732 3:195757994-195758016 ACATGGGGCAAAAGGGATGCAGG + Intronic
968446409 4:654413-654435 ACGTGGGGAGATGGGGCAGCAGG - Intronic
968614912 4:1573420-1573442 AGCTGGGGAAAAAGAGGAGCTGG - Intergenic
968660384 4:1796364-1796386 AGGTGGGGAGACAGGGAGGCTGG + Intronic
968910622 4:3475484-3475506 ACCTGGGAAGACAGGGGAGGTGG + Intronic
969437767 4:7198638-7198660 ACCTGGAGAGAGACAGAAGCAGG + Intronic
969549376 4:7854346-7854368 AGCTGAGGAGACAGGCAAGCGGG + Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969888282 4:10236223-10236245 ACCACGGGAGAAAGAGAGGCTGG + Intergenic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
970302517 4:14696415-14696437 ACCAAAGGAGAAAGGGAAGGAGG + Intergenic
970421094 4:15906182-15906204 ACCTGGAGAAAAAGGGAACTCGG - Intergenic
970575807 4:17426503-17426525 ATCAGGGGATTAAGGGAAGCTGG + Intergenic
971304985 4:25472205-25472227 AACTGGGGAGAAATGGGAACAGG - Intergenic
971756806 4:30717963-30717985 ACCTGGGAAAAAGGGGAACCAGG + Intergenic
972056249 4:34806536-34806558 TTCTGGGGAGAAATTGAAGCTGG - Intergenic
972790510 4:42367195-42367217 AGCTGATGAGAAAGGGAAGCAGG - Intergenic
972799721 4:42462161-42462183 TTCTGAGGAGAAATGGAAGCAGG + Intronic
973218416 4:47697770-47697792 CCATGAGGAGAAAGGGGAGCTGG + Intronic
973295954 4:48521027-48521049 AGGTGGGGAGAAATGGAGGCTGG - Exonic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
977656154 4:99523144-99523166 ACCTGGGGAGAAAGGAAGGATGG - Intronic
977765653 4:100794977-100794999 TCCTGTAGAGAAAGAGAAGCAGG + Intronic
978643362 4:110897928-110897950 ACATGTAAAGAAAGGGAAGCAGG - Intergenic
979122981 4:116926476-116926498 ACCTGGGGAGAAGGCAAGGCAGG + Intergenic
980114962 4:128670483-128670505 GCCTGGGGAGCATGGGAAGAAGG - Intergenic
980701500 4:136437872-136437894 AACTGGAGAGCCAGGGAAGCTGG - Intergenic
981131312 4:141161493-141161515 ATCTGGGGAGAAATTCAAGCAGG + Intronic
981368458 4:143930130-143930152 TCCTGGGGAGAAATTCAAGCTGG - Intergenic
981676399 4:147348015-147348037 AGCTGAGGAGAAAGGAGAGCCGG + Intergenic
982274818 4:153628116-153628138 AGTTGGGGAGGAAGGGAAGCAGG - Intronic
982774650 4:159429235-159429257 ACCTGGGAAGCCAGGGAGGCAGG - Intergenic
984026262 4:174547267-174547289 ATCTGGGGAGAAATTCAAGCTGG + Intergenic
985661025 5:1156458-1156480 ACCTGGGGAGAAAGGCCTCCGGG + Intergenic
986070820 5:4280639-4280661 ATCTGGGGAGAACAGGAGGCTGG - Intergenic
986310572 5:6547820-6547842 ACCTGGGAAGAAAAGGAAGAGGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
986842148 5:11710201-11710223 AGATGGAGACAAAGGGAAGCAGG - Intronic
986904845 5:12484277-12484299 ATCTGGGGAGAGGGGGAAACAGG + Intergenic
987135656 5:14897339-14897361 ACCTGGTGACAAAAGGAAGATGG + Intergenic
987810134 5:22823809-22823831 ATCATGGCAGAAAGGGAAGCAGG - Intronic
988692291 5:33584972-33584994 TCCTTGGCAGAAAGGGAAGTGGG - Intronic
989099196 5:37808704-37808726 CCCTGGGGAGCAGGGGAGGCGGG - Intergenic
990727710 5:58774954-58774976 CTCTGGGGAAAATGGGAAGCTGG + Intronic
990731757 5:58816362-58816384 ACCTGAGGAGAAAGGGAGCTGGG + Intronic
992132598 5:73708344-73708366 AGGTGGGGAGAAAGGGAGGGAGG - Intronic
992552144 5:77868984-77869006 CACTGGGGAGAAGGGGAAGCTGG + Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993208750 5:84921116-84921138 TTCTGGGGAGAAATGCAAGCTGG + Intergenic
994905797 5:105839724-105839746 TTCTGGGGAGAAATGCAAGCTGG - Intergenic
995287681 5:110410145-110410167 ACTTGGTGAGAAAGGAAAGCAGG - Intronic
995703647 5:114962370-114962392 TCCTGGGGAGAAATTCAAGCTGG - Intergenic
995831667 5:116361474-116361496 ACCTGCGGAGGGAGGGAGGCCGG - Intronic
996278143 5:121693838-121693860 AGCGGGGGAAAAAGGGAAACAGG + Intergenic
997079638 5:130723394-130723416 ACCATGGCAGAATGGGAAGCAGG + Intergenic
997372311 5:133369920-133369942 ACCTGGGGAGGGAGGGAGGGAGG - Intronic
997470778 5:134115610-134115632 ACCTGGGCAGGAGGGGAGGCGGG - Intronic
997674637 5:135703643-135703665 TCCTGGGGAGAAAGTAAAGCAGG - Intergenic
997710858 5:136003442-136003464 ACCTGGGGAAAAAGGGAGCAGGG - Intergenic
997835309 5:137187262-137187284 CCCTGGGGAGGAGGAGAAGCAGG - Intronic
998015050 5:138725114-138725136 GCCTGGGGAGAGAGGGAAAAGGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998175941 5:139902186-139902208 AGCTGGGGAGAAGGGGAAATGGG + Intronic
998262357 5:140641193-140641215 ACCTGAAGAGAGTGGGAAGCTGG + Intronic
998921499 5:147073298-147073320 AGCTCTGGAGGAAGGGAAGCGGG - Intronic
999249501 5:150173860-150173882 ACTTGGGGAGCAAGGGAGACAGG + Intronic
1001433640 5:171682847-171682869 TCACGGGGAGAAGGGGAAGCAGG + Intergenic
1001616165 5:173045281-173045303 AGCTGTGGAGAGAGGGGAGCTGG - Intergenic
1001626955 5:173144322-173144344 ACATGGAGAGGAAGGGAAGAGGG - Intergenic
1001721002 5:173856833-173856855 ACCGGGAGAGAGAGGAAAGCTGG - Intergenic
1001919282 5:175587714-175587736 AAGAAGGGAGAAAGGGAAGCTGG + Intergenic
1002064190 5:176643924-176643946 GCCTGGGGAGCAGGAGAAGCAGG + Intronic
1003180415 6:3786198-3786220 GACTGCAGAGAAAGGGAAGCAGG + Intergenic
1003863217 6:10340738-10340760 TGCTGGGAAGAAAGGGAGGCAGG - Intergenic
1004581516 6:16958696-16958718 AGTGGGGTAGAAAGGGAAGCAGG + Intergenic
1005499664 6:26418685-26418707 TTCTGAGGAGAAAGGCAAGCTGG - Intergenic
1005657514 6:27956618-27956640 GACTGGGGGGAAAGGGAAGGAGG + Intergenic
1005803398 6:29449280-29449302 ACCTAGGGAGGAAGGGCAGGAGG + Intronic
1005835076 6:29702643-29702665 GGCTAGGGAGAAAGGGGAGCGGG + Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1005956276 6:30665523-30665545 AGCTGGGGAGCAGGAGAAGCTGG - Exonic
1006010997 6:31042893-31042915 ACCTGGGCTGCAGGGGAAGCTGG - Intergenic
1006063273 6:31441834-31441856 GGCTGGGGAGAAAGGGGAGCGGG - Intergenic
1006178981 6:32142403-32142425 ACATAGGGCGAGAGGGAAGCAGG + Intergenic
1006644350 6:35505852-35505874 ACCTGGGGAAAAGGGGAGACAGG + Exonic
1006789011 6:36686562-36686584 AGCTGGAGAAAAAGGGTAGCTGG - Exonic
1006806595 6:36793230-36793252 GGCAGGGGAGGAAGGGAAGCCGG + Intronic
1007498517 6:42278587-42278609 TCCTGGGGAGCCAGGCAAGCTGG - Intronic
1007630775 6:43272106-43272128 ACCTGGGGTGGATGGGAAGAGGG - Intronic
1007712125 6:43831135-43831157 ACATGGGGAGAAGGGGCAGGTGG + Intergenic
1007936940 6:45740885-45740907 GGCTGGGCAGAAAGGGGAGCAGG + Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008246406 6:49179140-49179162 AGCTGGAGAAACAGGGAAGCTGG - Intergenic
1008446190 6:51594919-51594941 CCCTGAGGAGAAAGGAAACCAGG - Intergenic
1009929257 6:70156702-70156724 ACCTGGGGAGAAAGGCGATGAGG + Exonic
1010016789 6:71113880-71113902 ACCAGGGGACTAAGGGAACCAGG + Intergenic
1011187104 6:84689466-84689488 GCCTGAGGAGAAAGGGGTGCTGG + Intronic
1011409137 6:87048152-87048174 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1011629240 6:89308689-89308711 AAATGGAGAGAAAGAGAAGCAGG - Intronic
1011697642 6:89926987-89927009 ACCTGGGGAGGAAGAGAAGAGGG + Exonic
1011860946 6:91755450-91755472 ACCTAGGGAGATAGGGAAAAGGG + Intergenic
1011895203 6:92216773-92216795 TTCTGGGGAGAAATTGAAGCTGG + Intergenic
1012200875 6:96404531-96404553 AGCTGCAGAGAAAGGGAACCTGG + Intergenic
1012309775 6:97708737-97708759 ACGAGGAGAGAAAGGGAAGCTGG - Intergenic
1013019983 6:106204724-106204746 ATCATGGCAGAAAGGGAAGCAGG - Intronic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013660978 6:112296750-112296772 ACCAAGGGAGAGAGGGTAGCTGG + Intergenic
1014594082 6:123311164-123311186 ATCATGGCAGAAAGGGAAGCAGG + Intronic
1015440785 6:133243008-133243030 ACCTTGGCAGAAAGGGCAGAGGG - Intronic
1015771580 6:136773581-136773603 ATCTAGTGAGAAAGGGAAGATGG - Intronic
1016085043 6:139902991-139903013 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1016243078 6:141954105-141954127 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1017047958 6:150364840-150364862 ACCAGGGGGCAAAGGGTAGCAGG - Intergenic
1017569329 6:155726277-155726299 ATCATGGCAGAAAGGGAAGCAGG - Intergenic
1018189184 6:161293494-161293516 AGCTGCAGAGAAAGGGAACCTGG + Intergenic
1019749547 7:2720304-2720326 ACGTGGGGAGACATGGAAACGGG - Intronic
1019887285 7:3916236-3916258 ACATGTGAAGAAAGGGAATCAGG + Intronic
1020329267 7:7001603-7001625 AGCTGGGGAAAGAGAGAAGCTGG + Intergenic
1020331161 7:7018150-7018172 ATGCGGGGAGAAAGGGAATCAGG + Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1022482835 7:30755158-30755180 TCCTGGGGATTAAGGGAAGGGGG + Intronic
1022515925 7:30974950-30974972 ACCTGGGGAGAGAGGAAAGAAGG - Exonic
1022637462 7:32150419-32150441 ACCTTTGAAGAAAGGGAGGCTGG - Intronic
1022838078 7:34135963-34135985 ATCTGGGGAGACAGGGCAGGAGG - Intronic
1023457789 7:40360531-40360553 ACCTAGAGAGAAAGTGAAGGTGG + Intronic
1023800276 7:43827729-43827751 AGCTGCAGAGAAAGGGAACCCGG + Intergenic
1024384693 7:48738383-48738405 TTCTGGGGAGAAATTGAAGCAGG + Intergenic
1024445512 7:49473672-49473694 ATCATGGGAGAAGGGGAAGCAGG + Intergenic
1024811595 7:53218928-53218950 AGCTGGGGCCAAATGGAAGCCGG - Intergenic
1025074511 7:55931528-55931550 AATTAGGGAGAAAGGGAAGGGGG - Intronic
1025874007 7:65462896-65462918 ACCTGGGGGGCAAAGGAAACTGG + Intergenic
1026149143 7:67773295-67773317 GCCTGGGGAGAAAGGAGCGCTGG + Intergenic
1026200638 7:68211637-68211659 ACCAGGGGAGAAGGGAAAGATGG - Intergenic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1029437951 7:100573194-100573216 ACCTGGGGGGAACGGGGATCTGG + Exonic
1029488796 7:100859126-100859148 AGCTGGAGAGAAAGAAAAGCAGG - Exonic
1029854518 7:103501778-103501800 ATCTGGGGTGAAATGGATGCTGG - Intronic
1030473908 7:110003572-110003594 ACCTGAGGATGAAGGGAAGGAGG + Intergenic
1030878861 7:114851155-114851177 GCCTGAGGAGAGAGGCAAGCAGG - Intergenic
1031576201 7:123418156-123418178 TTCTGGGGAGAAAGTCAAGCCGG - Intergenic
1032020850 7:128406349-128406371 CCCTGGGGAGAAGGGCAAGGTGG - Intronic
1032533992 7:132645423-132645445 ATCATGGCAGAAAGGGAAGCTGG - Intronic
1033115528 7:138621194-138621216 ACCTGGGGAGGAAGGGGAAGAGG - Intronic
1034451305 7:151138621-151138643 GCCTGGGGACAAAGGGGAGGAGG - Intronic
1034748179 7:153542737-153542759 ACCTGGGGAGAAGGGGAAACAGG + Intergenic
1034955831 7:155334079-155334101 ACCTGGGGAGAAAGGCTGGGTGG - Intergenic
1035459052 7:159028291-159028313 GCCTGGTGAGCAGGGGAAGCAGG - Exonic
1035607985 8:941550-941572 GCCTGTGGAGAAAGGGGAGCAGG - Intergenic
1035689620 8:1551461-1551483 ACCTGTGGAGAAGGCGCAGCTGG - Intronic
1035861622 8:3034921-3034943 CACTGTGGAGAAAGGGAAGGAGG + Intronic
1036006476 8:4670050-4670072 AACTCTGTAGAAAGGGAAGCTGG + Intronic
1037580108 8:20239977-20239999 ACCTGGAGAGAAAAGGTTGCAGG + Intergenic
1037771695 8:21804841-21804863 AGCAGGGGAGAAAGGGCAGTAGG - Intronic
1037772988 8:21813770-21813792 ACCACAAGAGAAAGGGAAGCAGG - Intergenic
1037837674 8:22223877-22223899 CCCTGGGGCCAAAGGGAAGGTGG - Intronic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1038275511 8:26117712-26117734 CACAGGGAAGAAAGGGAAGCAGG - Intergenic
1039065634 8:33605132-33605154 AACTGGGGAGAGAGGCACGCTGG + Intergenic
1039442902 8:37607827-37607849 ACCTGGAGAGGAAGCCAAGCAGG - Intergenic
1039475128 8:37835608-37835630 ACCGGGGGAGCCAGGGCAGCCGG - Exonic
1040795678 8:51288222-51288244 AAGAGGGGAGAAAGGGAAGGGGG - Intergenic
1040959497 8:53017090-53017112 AGCTGGGGAGAAGGGGAATAAGG - Intergenic
1040960291 8:53024769-53024791 GACTGGGGAGAGAGGGAAGGAGG - Intergenic
1040976095 8:53195885-53195907 ACCTGAAGAGAAAGGAAAGGAGG + Intergenic
1041273205 8:56129937-56129959 AGAGGAGGAGAAAGGGAAGCAGG + Intergenic
1041880486 8:62744090-62744112 CCTTGGGGAGAAAGGAAAGCAGG + Intronic
1042642842 8:70954634-70954656 ACCTGAGGATAAAGAGAAGTTGG - Intergenic
1042852918 8:73234549-73234571 CCCTGAGGAGAAAGGGAGGTGGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1042950083 8:74192254-74192276 ATCATGGGAGAAGGGGAAGCAGG + Intergenic
1043060405 8:75493293-75493315 TCCTGGGAAGAAATGGAGGCTGG + Intronic
1043544007 8:81294985-81295007 ACTTGGGGAGAAAGCCAAGGTGG + Intergenic
1043551559 8:81378837-81378859 ACCTGGAGAGACAAGGAGGCTGG - Intergenic
1043706495 8:83357579-83357601 AGCTGGAGAGGAAGGGAACCTGG - Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044826133 8:96199186-96199208 AGCTGGGGAGATGGGGAAGGAGG - Intergenic
1045062140 8:98419662-98419684 ACCTTGGGAGAAATGGATGCAGG + Intronic
1045078955 8:98603749-98603771 GCCTGGGAAGGAAGGGAAGAAGG + Intronic
1045109875 8:98930195-98930217 CCCTGGGGAGGAGGGGAAGGCGG + Intronic
1045139780 8:99267762-99267784 TTCTGGGGAGAAAGTGAAGCTGG + Intronic
1045291117 8:100833748-100833770 AGCTGGGGAGAAGGAAAAGCTGG + Intergenic
1045686159 8:104714294-104714316 ATCTGGGGTGGAAGGGAAACAGG + Intronic
1046369764 8:113286883-113286905 AAAGGGAGAGAAAGGGAAGCAGG + Intronic
1046922504 8:119747647-119747669 TACTGGGGAGAAAAGGAAGGCGG - Intronic
1047764231 8:127977281-127977303 TCCTGGGGGGAAACTGAAGCTGG + Intergenic
1047908483 8:129499498-129499520 ACCATGGCAGAAGGGGAAGCAGG + Intergenic
1048150355 8:131887714-131887736 ACCTGGGAAGAAAGGCAGGCAGG - Intergenic
1048367174 8:133748314-133748336 GCATGGGGAGAGAGGAAAGCTGG - Intergenic
1048645263 8:136412708-136412730 ACCTAGAGAGAAAGGGAAAAAGG + Intergenic
1048705477 8:137148387-137148409 AGGTGGAGAGAAAGGGAGGCAGG - Intergenic
1049402623 8:142436343-142436365 GCCTCGGGCGAAAGGGGAGCAGG - Intergenic
1049764955 8:144350878-144350900 CCCTGGGGAGAAAGGAAAGGGGG - Intergenic
1050120638 9:2303723-2303745 ATCTGGGGAGAAGGGGATGGTGG + Intergenic
1050162072 9:2729425-2729447 ACCTGTAGAGGAAGGAAAGCAGG - Exonic
1050498317 9:6267357-6267379 AGTTGGGGAAAAAGAGAAGCTGG - Intergenic
1050721388 9:8594709-8594731 ATCATGGCAGAAAGGGAAGCAGG - Intronic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051717052 9:19995932-19995954 ATCTGGGGAGAAAGGTAGACTGG + Intergenic
1053436852 9:38081444-38081466 ACGTGGGGAGAAAGGAAATCAGG + Intergenic
1055080888 9:72266536-72266558 TTCTGGGGAGAAATGTAAGCTGG - Intergenic
1055481365 9:76711885-76711907 ACCTGGGGTGAAAGGGACTGAGG - Intronic
1055552172 9:77441370-77441392 ACCGTGGCAGAAGGGGAAGCAGG - Intronic
1055882992 9:81024164-81024186 AACTGGGGAAAGAGAGAAGCTGG - Intergenic
1056577795 9:87869250-87869272 ACCTCGGGAGGAGGGGAAGAGGG + Intergenic
1056602798 9:88059622-88059644 ACCTGGGGGCAAGGGGAGGCGGG - Intergenic
1057298786 9:93864713-93864735 CCCTGGGTAGAAAAGGAAGGAGG - Intergenic
1057781392 9:98053711-98053733 AGCTGCAGAGAAAGGGAACCTGG - Intergenic
1058528000 9:105879232-105879254 CCCTGGGGGTAAGGGGAAGCTGG - Intergenic
1058913150 9:109539727-109539749 ACCTGGGGGGAAAGGGAAGACGG - Intergenic
1059287772 9:113190970-113190992 ATCTGTGGAGAAAAGGAAACAGG + Intronic
1059534874 9:115071249-115071271 TCCTGTGGAGAAAGGGATGGGGG + Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060913104 9:127366464-127366486 ACCTGGGGATGCAGGGCAGCAGG - Intronic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061120652 9:128640363-128640385 ACATGGGGAGGCAGGGCAGCCGG + Intronic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061262198 9:129486624-129486646 ACCTGGGGAGACTGGGAGGACGG - Intergenic
1061275312 9:129566727-129566749 ATCTGGGGAGCCAGGAAAGCTGG + Intergenic
1061681847 9:132246328-132246350 CCCTGGGGAGACAGGGAGGCGGG - Intergenic
1062109163 9:134772673-134772695 TCCTGGGGAGGAAGGGAAATGGG + Intronic
1062318336 9:135978753-135978775 CCCTGGGGAGGTAGAGAAGCTGG - Intergenic
1062365980 9:136209274-136209296 GCCTAGGAAGAAAAGGAAGCGGG + Exonic
1062492788 9:136815374-136815396 ACCTCAGGAGAAAGGCAAGAAGG - Intronic
1062577055 9:137213759-137213781 ACCTGTGGAGACAGTGAGGCTGG - Exonic
1185576311 X:1175489-1175511 AACTAGGGAGAAGGGGAAGTGGG - Intergenic
1186510504 X:10126512-10126534 ACCACGGGAGAAAGGGAGGATGG - Intronic
1186990567 X:15062782-15062804 ACAAGGGAAGTAAGGGAAGCAGG + Intergenic
1187221334 X:17329024-17329046 AACTGAGGAGAAAGGAGAGCAGG - Intergenic
1188268923 X:28114394-28114416 ACAAGAGGAGACAGGGAAGCAGG + Intergenic
1189774347 X:44456787-44456809 TGCAGGGGAGTAAGGGAAGCCGG + Intergenic
1189850761 X:45173995-45174017 GTCTGGGGAGAAAGAAAAGCAGG + Intronic
1190110101 X:47583739-47583761 ACCTGGGGGGAAAGTGTACCAGG - Intronic
1190221321 X:48514219-48514241 ACCTGGGGAGAAAGGGGCAGGGG - Exonic
1190363281 X:49668673-49668695 ACCTGTGGAGACAGGGAAAAGGG - Intergenic
1191867971 X:65720843-65720865 GCCTGGTGGGAAAGGGAAGTAGG + Intronic
1191953689 X:66621735-66621757 GCCTGGGGAGAAAGGGAAATGGG + Intronic
1192164483 X:68818787-68818809 AGGTGGGGAGAAAGGGAGGGGGG + Intergenic
1192181124 X:68916455-68916477 TCCTGGGGAGGGAAGGAAGCCGG - Intergenic
1192362352 X:70447706-70447728 ACCTGGGGAGACAGGCAAGAGGG + Intronic
1192564681 X:72153870-72153892 GCCTGGGGAGACAGGGATGCTGG - Intergenic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1194174264 X:90627786-90627808 AACTAGGGAAATAGGGAAGCTGG - Intergenic
1194403017 X:93461533-93461555 GCCTGGGGAGAAGGAGACGCTGG + Intergenic
1195456141 X:105072222-105072244 ATCATGGCAGAAAGGGAAGCAGG - Intronic
1195663853 X:107410260-107410282 AGCTGGGGAAAGAGAGAAGCTGG + Intergenic
1195668169 X:107449230-107449252 AACTGCGGAGAAGGGGCAGCAGG - Intergenic
1197073485 X:122327680-122327702 ACCATGGCAGAAGGGGAAGCAGG - Intergenic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1198070656 X:133145181-133145203 ACCTGGGTGGAAAGGGAACTAGG - Intergenic
1198677612 X:139147428-139147450 ACCTGTGCTGCAAGGGAAGCAGG + Intronic
1199686629 X:150270944-150270966 ACCCAGGGAGAGAAGGAAGCAGG + Intergenic
1200157567 X:153985444-153985466 GCCTGGGCAGGAAGGGATGCAGG - Intergenic
1200520482 Y:4205479-4205501 AACTAGGGAAATAGGGAAGCTGG - Intergenic
1201737013 Y:17278215-17278237 GGCTGGGGAGAAAGGGTAGGAGG + Intergenic
1201786030 Y:17780171-17780193 AGCTTAGGAAAAAGGGAAGCTGG - Intergenic
1201793968 Y:17874683-17874705 AGCTTAGGAGAAAGGGATGCTGG - Intergenic
1201807586 Y:18031302-18031324 AGCTTAGGAGAAAGGGATGCTGG + Intergenic
1201815523 Y:18125817-18125839 AGCTTAGGAAAAAGGGAAGCTGG + Intergenic
1201852222 Y:18497902-18497924 ATCTTAGGACAAAGGGAAGCTGG + Intergenic
1201881099 Y:18822482-18822504 ATCTTAGGACAAAGGGAAGCTGG - Intronic
1201940443 Y:19453023-19453045 AACTGCAGAGAAAGGGAAACTGG + Intergenic