ID: 1051357754

View in Genome Browser
Species Human (GRCh38)
Location 9:16255117-16255139
Sequence ACTCCCTGACCAGTCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051357746_1051357754 -1 Left 1051357746 9:16255095-16255117 CCCTTCGCCTGCTCCACTCCCCA 0: 1
1: 0
2: 3
3: 39
4: 483
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357742_1051357754 28 Left 1051357742 9:16255066-16255088 CCCTGAGATAACCCTGTGCTCAG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357747_1051357754 -2 Left 1051357747 9:16255096-16255118 CCTTCGCCTGCTCCACTCCCCAC 0: 1
1: 0
2: 2
3: 63
4: 706
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357743_1051357754 27 Left 1051357743 9:16255067-16255089 CCTGAGATAACCCTGTGCTCAGC 0: 1
1: 0
2: 1
3: 18
4: 147
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357745_1051357754 16 Left 1051357745 9:16255078-16255100 CCTGTGCTCAGCTTCTTCCCTTC 0: 1
1: 0
2: 3
3: 46
4: 484
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357744_1051357754 17 Left 1051357744 9:16255077-16255099 CCCTGTGCTCAGCTTCTTCCCTT 0: 1
1: 1
2: 7
3: 52
4: 531
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data
1051357748_1051357754 -8 Left 1051357748 9:16255102-16255124 CCTGCTCCACTCCCCACTCCCTG 0: 1
1: 0
2: 10
3: 147
4: 1181
Right 1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051357754 Original CRISPR ACTCCCTGACCAGTCTCCCA GGG Intronic
No off target data available for this crispr