ID: 1051358195

View in Genome Browser
Species Human (GRCh38)
Location 9:16259117-16259139
Sequence CTCCTGCATGTCCTTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051358192_1051358195 24 Left 1051358192 9:16259070-16259092 CCTTGGCTTTTCTTGGTAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1051358195 9:16259117-16259139 CTCCTGCATGTCCTTCAAAGAGG No data
1051358191_1051358195 25 Left 1051358191 9:16259069-16259091 CCCTTGGCTTTTCTTGGTAGGAG 0: 1
1: 0
2: 1
3: 26
4: 195
Right 1051358195 9:16259117-16259139 CTCCTGCATGTCCTTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051358195 Original CRISPR CTCCTGCATGTCCTTCAAAG AGG Intronic
No off target data available for this crispr