ID: 1051359914

View in Genome Browser
Species Human (GRCh38)
Location 9:16272817-16272839
Sequence CTGTGCCAGTAGCAAGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051359914_1051359919 -8 Left 1051359914 9:16272817-16272839 CCCTAGACTTGCTACTGGCACAG 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1051359919 9:16272832-16272854 TGGCACAGGGTGGCCTGAGATGG No data
1051359914_1051359921 14 Left 1051359914 9:16272817-16272839 CCCTAGACTTGCTACTGGCACAG 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1051359921 9:16272854-16272876 GCCAGTCGATGTCCCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051359914 Original CRISPR CTGTGCCAGTAGCAAGTCTA GGG (reversed) Intronic
900630946 1:3634858-3634880 ATGTCACAGTAGCAAGTTTACGG + Intronic
902502965 1:16922681-16922703 CTGTGCCAGGAGAAAGGCTTGGG + Exonic
907793398 1:57690534-57690556 CTGTGCAAGTAGCATGGCTTGGG - Intronic
908257736 1:62316863-62316885 CTGTGACAGAAGCATGTCCAGGG + Intronic
911724468 1:101227998-101228020 CTGAGCCAGGAGCTAGTCTGGGG - Intergenic
914389987 1:147212262-147212284 CAGTGCCAGTGGCAAATATAGGG - Intronic
917208158 1:172600083-172600105 CTGTGCCTGTAGCAACTGGATGG - Exonic
918493119 1:185104294-185104316 CTGTGCCAGCAGGAAGTGAAAGG + Intergenic
920688715 1:208129522-208129544 CTCTGCCAGTATCAAGTTTTGGG + Intronic
1069275376 10:66585223-66585245 CTATGTCACTAGCAAGTCCAGGG + Intronic
1071615091 10:87067843-87067865 CTGTTCCAGTGACAAGTATAGGG + Intronic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1076590770 10:131580578-131580600 CTGTGCTCGCAGCAAGTCCAGGG + Intergenic
1081688258 11:45057663-45057685 CTGTGACAGCAGCACGTCCATGG + Intergenic
1088474346 11:110219723-110219745 CTGAGGCAGGAGCAAGTTTAAGG + Intronic
1093706930 12:22284734-22284756 TTGTGCCAGTTGCAAGACCAAGG - Intronic
1095892360 12:47246750-47246772 ATGTGCCAGTCACAATTCTAAGG - Intergenic
1099781403 12:87200415-87200437 CTTTTCCAGGAGCAAGCCTAGGG - Intergenic
1101538720 12:105644731-105644753 CTGAGCCAGTTGCAAGAATAGGG + Intergenic
1102420091 12:112796622-112796644 CTTTGCCTGTAGCAAATCTGAGG - Intronic
1104648417 12:130513476-130513498 CTGTTCCTGTAGCAGGTCTGAGG - Intronic
1107347329 13:39475796-39475818 CGGTTCCAGTAAAAAGTCTAAGG + Intronic
1107814080 13:44228674-44228696 CAGTTCCAGAAGCAGGTCTAGGG - Intergenic
1109075327 13:57826763-57826785 ATGTGGCAGAAGGAAGTCTATGG + Intergenic
1113439747 13:110319060-110319082 CTGTCCCAGTACCATGGCTAAGG - Intronic
1117704940 14:58455772-58455794 CTGTGCAAGTAGGAAGTGAAAGG - Intronic
1122814588 14:104306282-104306304 CTGTTTCAGGAGCAAGTCTCAGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123817934 15:23998605-23998627 TTTTGCCAGGAGCTAGTCTAAGG + Intergenic
1126340480 15:47635575-47635597 CGATGCCAGTCGCAAGTCCAGGG - Intronic
1128886195 15:71290207-71290229 CTGTGCCAGCACCAGGCCTAAGG - Intronic
1129513837 15:76144461-76144483 GAGTGCCAGTACCAAGTCAAGGG + Intronic
1129579760 15:76795424-76795446 CTGTGCCAGTTGAACCTCTATGG + Exonic
1131506098 15:93020718-93020740 TTGTGAGAGTAGCAAGTCCAGGG + Intronic
1132467255 16:83060-83082 CTGTGCCATTAGGAAGTCGCCGG - Exonic
1137576636 16:49604342-49604364 CTGTGCCACTACCAGGGCTAGGG - Intronic
1138132306 16:54490952-54490974 CTGAGCCAGTCGCAAATGTATGG - Intergenic
1139039959 16:62987685-62987707 GTGTGCCAGTTGCATGTCTATGG - Intergenic
1147814484 17:43199131-43199153 AAGTGCGAGTAGCAAGTTTATGG + Intronic
1151598257 17:75090984-75091006 CTCTGCCAGGAAGAAGTCTATGG - Intronic
1157739873 18:50082990-50083012 CACTGCCAGTGCCAAGTCTAAGG + Intronic
1166631704 19:44412464-44412486 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1166635921 19:44451991-44452013 GTGTGACAGTAGCAAGTAAAAGG + Intergenic
1202648540 1_KI270706v1_random:161179-161201 GTGTGACAGTAGCAAGTAGATGG + Intergenic
926722351 2:15970473-15970495 CTCTGCATGGAGCAAGTCTATGG - Intergenic
926751351 2:16201043-16201065 CTGTGGCTGAAGCAAGTCTCTGG - Intergenic
927972824 2:27316495-27316517 CTGTGCCTGCAGCAACTCCAAGG + Intronic
928860732 2:35854503-35854525 ATGTGGCATTAGCAATTCTATGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937079706 2:119131960-119131982 CTGTGCCAGTACCAAGAAAAGGG + Intergenic
938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG + Intergenic
940231960 2:151464523-151464545 CTGTGCCAGAATCAAATCTAAGG + Exonic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
947775670 2:232707253-232707275 CTGGGCCAGGAGGAAGTCTTGGG + Intronic
1171274685 20:23846387-23846409 CTATGACACTAGCAAGTTTAGGG - Intergenic
1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1173631652 20:44520910-44520932 CTGTGCCAATGGCAAGCCTCAGG - Intronic
1173774761 20:45695175-45695197 AGGTGCCAGTTGCAAGTCTTGGG - Intronic
1174480372 20:50827121-50827143 CTGTTCCAGGATCCAGTCTAAGG + Intronic
1176603313 21:8811508-8811530 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1177826755 21:26092771-26092793 GTGTGCAGGTAGCAAGTATATGG + Intronic
1180345598 22:11703065-11703087 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180352117 22:11814247-11814269 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180353365 22:11821306-11821328 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180384874 22:12171051-12171073 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180386091 22:12177819-12177841 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1182892769 22:33832665-33832687 CCCAGCCAGTAGCAAGTCTGGGG - Intronic
1182974541 22:34610769-34610791 GTCTGCCAGTAGCAATTCCAAGG + Intergenic
1183581462 22:38728985-38729007 CTGCCCCCGTAACAAGTCTAGGG - Intronic
1185031399 22:48445106-48445128 CTCTGCAAGGAGTAAGTCTATGG + Intergenic
954814466 3:53269911-53269933 CTGTGCCAGTAGTAATCCTAGGG - Intergenic
955238089 3:57157393-57157415 CTGGGCCAGGAGCAAGACAAAGG - Intronic
956497172 3:69840256-69840278 CTGTGCCAGGAACACTTCTATGG + Intronic
959457802 3:106585213-106585235 TTTTGCCTGTAGCAAGTCTGAGG - Intergenic
963778869 3:149466651-149466673 CTGCTCCAGTGGGAAGTCTAAGG + Intergenic
964544645 3:157820521-157820543 CTCTGCCAATAGTCAGTCTAAGG - Intergenic
973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG + Intergenic
973376567 4:49291184-49291206 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973377487 4:49297336-49297358 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973378405 4:49303472-49303494 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973379752 4:49311891-49311913 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973380655 4:49318031-49318053 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973382645 4:49331098-49331120 GTGTGCCAGTAGCAAGTAGATGG - Intergenic
973386255 4:49516147-49516169 GTGTGACAGTAGCAAGTAGATGG - Intergenic
976543739 4:86308957-86308979 ATGTGCCAGGAGCTATTCTAAGG - Intronic
979108141 4:116714136-116714158 CTGTGCCAGTTCCAGGTCTAAGG - Intergenic
981506149 4:145502097-145502119 CTATCCCAGGAGAAAGTCTATGG - Intronic
989589795 5:43102752-43102774 GTGAGCCAGGAGCAAGTCTGGGG + Intronic
1000827096 5:166058544-166058566 GTATGCCAGTAGCAAGTTTTGGG + Intergenic
1003996396 6:11545165-11545187 CTGTGTCAGCAGCAAATGTAGGG + Intronic
1007461776 6:42024551-42024573 CAGTGCCAGTGGCATGGCTAAGG - Intronic
1007550544 6:42726746-42726768 CTGAGCCCATAGCAAGTCTGTGG + Intergenic
1011194479 6:84767130-84767152 CTTAGCCAGTAGCAGGACTAGGG - Intergenic
1013135093 6:107274620-107274642 CTGTGCCAGATACTAGTCTAAGG + Intronic
1018280446 6:162179740-162179762 TTGAGCCAGTGGCAACTCTAGGG - Intronic
1020833068 7:13114900-13114922 CTGTGGCATGAGCAAGTCTTGGG - Intergenic
1029024640 7:97403276-97403298 CTGGGCCAGGAGCCAGTCTTAGG - Intergenic
1031303704 7:120097515-120097537 CTGTGACAGCACCAAGTCCATGG - Intergenic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034733558 7:153409645-153409667 TTCTGCCATAAGCAAGTCTAAGG + Intergenic
1038095425 8:24304200-24304222 ATGAGCCAGTAACTAGTCTATGG - Intronic
1038217963 8:25580088-25580110 CTGTGCCAGTACCAAGAAGATGG - Intergenic
1039341413 8:36654231-36654253 CTGTGTCAGCAGAAATTCTAAGG - Intergenic
1045426696 8:102074183-102074205 CAGAGCCAGAAGCTAGTCTATGG + Intronic
1046565209 8:115890838-115890860 CTGTGACAGTAACATGTCTTAGG + Intergenic
1050850532 9:10279384-10279406 ATGAGCTAGTAGCAGGTCTAGGG - Intronic
1051359914 9:16272817-16272839 CTGTGCCAGTAGCAAGTCTAGGG - Intronic
1061744937 9:132732744-132732766 CTGTGCCTGTAGCCAGCCTCAGG + Intronic
1203698471 Un_GL000214v1:117248-117270 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203699389 Un_GL000214v1:123399-123421 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203700333 Un_GL000214v1:129682-129704 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203701255 Un_GL000214v1:135702-135724 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203480082 Un_GL000224v1:4285-4307 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203481052 Un_GL000224v1:10613-10635 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203482015 Un_GL000224v1:16922-16944 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203416733 Un_KI270330v1:322-344 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203548581 Un_KI270743v1:150642-150664 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203549838 Un_KI270743v1:157763-157785 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203550777 Un_KI270743v1:163928-163950 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1203569680 Un_KI270744v1:119636-119658 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1186708877 X:12172018-12172040 CTGTGCCAGCAGAAATTCAAGGG - Intronic
1188856730 X:35205717-35205739 CTGTGCTAGAAGAAAGTCAAAGG + Intergenic
1193130784 X:77917520-77917542 AAGTGCCAGTAGGAAGTCCAAGG + Intronic
1193242681 X:79190331-79190353 CATTGACAGTAGCAATTCTAAGG + Intergenic
1199002067 X:142650761-142650783 CTGTGCCTGGAGCAAGCCTGAGG + Intergenic
1201770635 Y:17614203-17614225 TTCTGCCATAAGCAAGTCTAAGG - Intergenic
1201830920 Y:18291783-18291805 TTCTGCCATAAGCAAGTCTAAGG + Intergenic