ID: 1051362226

View in Genome Browser
Species Human (GRCh38)
Location 9:16291372-16291394
Sequence CATGGTGACTGTAGTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051362221_1051362226 -7 Left 1051362221 9:16291356-16291378 CCAAAGTCCCTGCCTTCATGGTG No data
Right 1051362226 9:16291372-16291394 CATGGTGACTGTAGTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051362226 Original CRISPR CATGGTGACTGTAGTACAGT GGG Intergenic
No off target data available for this crispr