ID: 1051364553

View in Genome Browser
Species Human (GRCh38)
Location 9:16312217-16312239
Sequence GAGATGTAGTACGGCCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051364553_1051364556 12 Left 1051364553 9:16312217-16312239 CCGAGGTGGCCGTACTACATCTC No data
Right 1051364556 9:16312252-16312274 ACACACACACATATCCCGCTGGG No data
1051364553_1051364557 18 Left 1051364553 9:16312217-16312239 CCGAGGTGGCCGTACTACATCTC No data
Right 1051364557 9:16312258-16312280 ACACATATCCCGCTGGGATGTGG No data
1051364553_1051364555 11 Left 1051364553 9:16312217-16312239 CCGAGGTGGCCGTACTACATCTC No data
Right 1051364555 9:16312251-16312273 CACACACACACATATCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051364553 Original CRISPR GAGATGTAGTACGGCCACCT CGG (reversed) Intergenic
No off target data available for this crispr