ID: 1051370942

View in Genome Browser
Species Human (GRCh38)
Location 9:16358503-16358525
Sequence TGGTAGGGATGGTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051370934_1051370942 -4 Left 1051370934 9:16358484-16358506 CCTCCAGGGCAGATTCTTGTGGT No data
Right 1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG No data
1051370935_1051370942 -7 Left 1051370935 9:16358487-16358509 CCAGGGCAGATTCTTGTGGTAGG No data
Right 1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG No data
1051370932_1051370942 4 Left 1051370932 9:16358476-16358498 CCATAGCTCCTCCAGGGCAGATT No data
Right 1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051370942 Original CRISPR TGGTAGGGATGGTGGGAAGT GGG Intergenic
No off target data available for this crispr