ID: 1051372525

View in Genome Browser
Species Human (GRCh38)
Location 9:16370672-16370694
Sequence ATGAATGCACAGTTGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051372525_1051372526 -2 Left 1051372525 9:16370672-16370694 CCATGATTCAACTGTGCATTCAT No data
Right 1051372526 9:16370693-16370715 ATAATTATTTCATAAATAAATGG No data
1051372525_1051372528 10 Left 1051372525 9:16370672-16370694 CCATGATTCAACTGTGCATTCAT No data
Right 1051372528 9:16370705-16370727 TAAATAAATGGCTTCTGGAGAGG No data
1051372525_1051372527 5 Left 1051372525 9:16370672-16370694 CCATGATTCAACTGTGCATTCAT No data
Right 1051372527 9:16370700-16370722 TTTCATAAATAAATGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051372525 Original CRISPR ATGAATGCACAGTTGAATCA TGG (reversed) Intergenic
No off target data available for this crispr