ID: 1051375247

View in Genome Browser
Species Human (GRCh38)
Location 9:16395769-16395791
Sequence ATGTGTAAGTACATTTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051375247_1051375248 2 Left 1051375247 9:16395769-16395791 CCAAGGAAAATGTACTTACACAT No data
Right 1051375248 9:16395794-16395816 AAATATGTAATTATATTTTGTGG No data
1051375247_1051375249 3 Left 1051375247 9:16395769-16395791 CCAAGGAAAATGTACTTACACAT No data
Right 1051375249 9:16395795-16395817 AATATGTAATTATATTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051375247 Original CRISPR ATGTGTAAGTACATTTTCCT TGG (reversed) Intergenic
No off target data available for this crispr