ID: 1051379726 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:16443810-16443832 |
| Sequence | AAGTGGATTAGTAGTTGCCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4267 | |||
| Summary | {0: 2, 1: 28, 2: 262, 3: 1050, 4: 2925} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051379720_1051379726 | 21 | Left | 1051379720 | 9:16443766-16443788 | CCAAGCATATGAAATTCTGGAAA | 0: 1 1: 4 2: 59 3: 552 4: 1463 |
||
| Right | 1051379726 | 9:16443810-16443832 | AAGTGGATTAGTAGTTGCCAGGG | 0: 2 1: 28 2: 262 3: 1050 4: 2925 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051379726 | Original CRISPR | AAGTGGATTAGTAGTTGCCA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||