ID: 1051379726

View in Genome Browser
Species Human (GRCh38)
Location 9:16443810-16443832
Sequence AAGTGGATTAGTAGTTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4267
Summary {0: 2, 1: 28, 2: 262, 3: 1050, 4: 2925}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051379720_1051379726 21 Left 1051379720 9:16443766-16443788 CCAAGCATATGAAATTCTGGAAA 0: 1
1: 4
2: 59
3: 552
4: 1463
Right 1051379726 9:16443810-16443832 AAGTGGATTAGTAGTTGCCAGGG 0: 2
1: 28
2: 262
3: 1050
4: 2925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051379726 Original CRISPR AAGTGGATTAGTAGTTGCCA GGG Intronic
Too many off-targets to display for this crispr