ID: 1051383804

View in Genome Browser
Species Human (GRCh38)
Location 9:16485500-16485522
Sequence GACTGGGTTAATGCAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051383804_1051383808 -8 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383808 9:16485515-16485537 ACCCAGTCAAGGGATCATATAGG No data
1051383804_1051383813 7 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383813 9:16485530-16485552 CATATAGGCTCTGTCAGGGCCGG No data
1051383804_1051383814 23 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383814 9:16485546-16485568 GGGCCGGTCCTCCACCCCACTGG No data
1051383804_1051383815 24 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383815 9:16485547-16485569 GGCCGGTCCTCCACCCCACTGGG No data
1051383804_1051383812 3 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383812 9:16485526-16485548 GGATCATATAGGCTCTGTCAGGG No data
1051383804_1051383811 2 Left 1051383804 9:16485500-16485522 CCCAACTTTGCATTAACCCAGTC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1051383811 9:16485525-16485547 GGGATCATATAGGCTCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051383804 Original CRISPR GACTGGGTTAATGCAAAGTT GGG (reversed) Intronic
900702526 1:4057184-4057206 GACTGGCATACTGTAAAGTTAGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905511000 1:38520021-38520043 GAGTGGGTTAGAGCAGAGTTGGG + Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
908669917 1:66534392-66534414 GACTGGCTTCAGGCAAGGTTTGG + Intronic
909773187 1:79451762-79451784 GTGTGGGATAATGCAAAGTTAGG - Intergenic
911152658 1:94610005-94610027 GCCTGGGTTAATGGATATTTAGG + Intergenic
911978099 1:104528781-104528803 CACTGGGTTAATTCTAATTTAGG - Intergenic
914676829 1:149912547-149912569 GCATGGGAAAATGCAAAGTTTGG - Intronic
916400459 1:164442288-164442310 GACTTTCTTAATCCAAAGTTGGG - Intergenic
917712976 1:177706083-177706105 GACTGTGCTAATGCAGGGTTTGG + Intergenic
919514566 1:198506876-198506898 GACTTGGTTGATGCACATTTAGG + Intergenic
922020641 1:221700828-221700850 CACTGGGTTAATGCATAGCTGGG - Intergenic
922314526 1:224431671-224431693 GACTGGGATAAGGTAAAGTAGGG - Exonic
923127388 1:231043883-231043905 GGCTGGGTTAATGGAAGGTCAGG - Intergenic
923364910 1:233249686-233249708 GTCTGCTTTAATGCAAAGCTTGG + Intronic
924097873 1:240573019-240573041 GACTGGAATGATGCAAAGTGAGG + Intronic
1064435743 10:15309891-15309913 GACTGGGTAAATGTTCAGTTAGG + Intronic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065563151 10:26983644-26983666 AAATGGGGTAATGCAAATTTGGG - Intergenic
1066720982 10:38338498-38338520 GACTGGGTTATTACTAGGTTTGG - Intergenic
1068751014 10:60592457-60592479 AACTGAGTTAATACAAATTTTGG + Intronic
1069389029 10:67912609-67912631 TACAGGGTTACAGCAAAGTTTGG - Exonic
1070869522 10:79738247-79738269 GACTGGGATAGGGTAAAGTTTGG + Intergenic
1071636442 10:87260454-87260476 GACTGGGATAGGGTAAAGTTTGG + Intergenic
1071658803 10:87477491-87477513 GACTGGGATAGGGTAAAGTTTGG - Intergenic
1079997711 11:27312978-27313000 TAGTGTGTAAATGCAAAGTTCGG + Intergenic
1089510880 11:118996414-118996436 GCCTGGGTTGATCCAAAATTGGG + Intergenic
1090575623 11:128099690-128099712 GACTGGGCTAATGCTACATTTGG - Intergenic
1096477119 12:51915107-51915129 GACTGGGTCACTGCTAAGCTAGG - Intronic
1096847460 12:54415633-54415655 GACTTGGTTAATCAAAAGCTGGG - Intronic
1097802257 12:63927493-63927515 GACTGGGTTAAGAGAAAGTGGGG - Intronic
1098308740 12:69126946-69126968 AACTGGGGTAATCCAAAGTCTGG + Intergenic
1098991732 12:77071218-77071240 GACTGGGTGAATTTTAAGTTGGG + Intergenic
1099679266 12:85804225-85804247 AACTGCATTAATTCAAAGTTTGG - Exonic
1099818150 12:87674802-87674824 GAATAGATTAATGCAAAGTCAGG - Intergenic
1104889462 12:132133246-132133268 CACTGGGTAGATGCAAACTTGGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106450406 13:29876677-29876699 GAGTGAGTTAATGAAAAATTGGG + Intergenic
1106706528 13:32286409-32286431 GAATTGGTTTATGGAAAGTTTGG - Intronic
1106911864 13:34471602-34471624 GGCTGTGTTAATGCTAAGGTGGG + Intergenic
1107895779 13:44961195-44961217 GACTGAGTTTTTGCAAAGATAGG + Intronic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1124569109 15:30844011-30844033 GAATGGGTTCAAGCAATGTTGGG - Intergenic
1125925468 15:43559406-43559428 GAAGGGGTTCATGCAAATTTAGG + Intronic
1125938611 15:43658957-43658979 GAAGGGGTTCATGCAAATTTAGG + Intronic
1133571975 16:7050006-7050028 GACTGGGTTAATGGAAAAGGAGG - Intronic
1139296253 16:65903814-65903836 GTCTAGGATAATGCAAAGTAAGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144322196 17:14138324-14138346 GGCTAAGTTAATGTAAAGTTTGG - Intronic
1155648539 18:28111677-28111699 GCATGGGTTAACGCAAAATTTGG - Intronic
1157496349 18:48160256-48160278 GACTGGATTAATGCATCTTTTGG - Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159947081 18:74451802-74451824 GACTGGGATACTGAAAAGTTAGG - Intronic
1167958819 19:53089969-53089991 GATTGGGACAATGAAAAGTTTGG - Intronic
932512358 2:72306439-72306461 GACTAGGTTAATGCACATGTGGG - Intronic
932865793 2:75340474-75340496 GAGGTGGTTAATGAAAAGTTGGG - Intergenic
935323459 2:101911258-101911280 GACTGAGTTGATTCAAAATTAGG - Intergenic
936581945 2:113708218-113708240 GACTGCTTTACTGCAATGTTGGG - Intronic
937327790 2:121002166-121002188 GACTGGGTACAGGCAGAGTTTGG + Intergenic
939997367 2:148932456-148932478 GACAGTGTTAATGCTAAGCTCGG + Intronic
940502159 2:154506213-154506235 GACTTGGTCAATGAACAGTTAGG + Intergenic
942289870 2:174458157-174458179 GAATAAGTTAATGCAATGTTAGG + Intronic
944654003 2:201859585-201859607 TACTGGCTGAATTCAAAGTTTGG - Intronic
1174738591 20:52989272-52989294 CATTGTGTTAATACAAAGTTTGG + Intronic
1179136333 21:38683228-38683250 GACTGGGACAATGCCAATTTTGG - Intergenic
1180930492 22:19587219-19587241 TTCTGGGTAAATGCAATGTTTGG + Intergenic
950881918 3:16329093-16329115 GAATGGGTTAATGCCAACTCAGG + Intronic
951407171 3:22315252-22315274 GACTAGGTGAATGCAAGTTTGGG + Intronic
957295754 3:78330672-78330694 GATCTGGTTAATGCAAAGTGTGG + Intergenic
959811840 3:110628897-110628919 CATTGAGTTAATTCAAAGTTAGG - Intergenic
960874020 3:122278720-122278742 GACTGGTATAAAGCAGAGTTTGG + Intronic
976800113 4:88980523-88980545 GAATGGGTGATTGGAAAGTTTGG - Intronic
979943824 4:126799577-126799599 GTCTAAGTCAATGCAAAGTTTGG + Intergenic
984657846 4:182339017-182339039 CACTGGGGAAATGAAAAGTTTGG - Intronic
988927161 5:36001270-36001292 AAATGGGATAATGCAAATTTGGG + Intergenic
991318187 5:65336445-65336467 GTATGGGTTCATGCAAAGTGGGG - Intronic
998649561 5:144102818-144102840 TGCTGGGTTAATGCAAAGACAGG + Intergenic
999899676 5:156073197-156073219 GACGGAGTAGATGCAAAGTTAGG + Intronic
1000567906 5:162873782-162873804 TACTGGGTTATTGGAAATTTTGG + Intergenic
1000719866 5:164693254-164693276 GACTGGGAGAATGGACAGTTTGG + Intergenic
1002666612 5:180830228-180830250 GACTCTGTTACTGCAGAGTTTGG + Intergenic
1010619084 6:78052344-78052366 GAATGATTTACTGCAAAGTTTGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011280631 6:85673598-85673620 GACTGGATTAATCCAAAATCAGG - Intergenic
1014999721 6:128200167-128200189 TACTGGAATCATGCAAAGTTAGG + Intronic
1022728070 7:32998612-32998634 TACTGGGCTAATGGAAAGCTTGG + Intronic
1023225560 7:37965397-37965419 AACTGGGATAATGGAAAGATGGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1030092808 7:105872707-105872729 GACTGGGATGATGGAAAATTTGG + Intronic
1040490913 8:47921415-47921437 GACTGAGTTAATGGATACTTTGG + Intronic
1042667116 8:71219291-71219313 GACTTGATTAAAGCAAAGTTCGG + Intronic
1043364753 8:79520054-79520076 GACAGGGTTAAGGTAAATTTAGG - Intergenic
1046011701 8:108556481-108556503 CACTGAGTTAATGCAGAGCTTGG + Intergenic
1046607394 8:116387021-116387043 GACTGGGTTATTGTAAAGAAAGG - Intergenic
1048437878 8:134434498-134434520 GCCTGGCTTAATGCACACTTAGG - Intergenic
1050823900 9:9919327-9919349 GACTGGGTTGAGGTGAAGTTTGG - Intronic
1051383804 9:16485500-16485522 GACTGGGTTAATGCAAAGTTGGG - Intronic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1193440408 X:81534149-81534171 GACTGAGTTAATGCAAAAAGTGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196070165 X:111511934-111511956 GACTATGTTCATGCAAAGTATGG - Intergenic
1198423090 X:136487440-136487462 GCCTGGATAACTGCAAAGTTGGG + Intergenic
1199640259 X:149853802-149853824 GTTTGGGGTACTGCAAAGTTGGG - Intergenic
1200356598 X:155558656-155558678 GACTGGGTCAATCCAAAGGTAGG + Intronic
1202029268 Y:20554603-20554625 GACTGGGTTTAGGCAAAGACAGG + Intergenic