ID: 1051385066

View in Genome Browser
Species Human (GRCh38)
Location 9:16499019-16499041
Sequence ACCTGCCATAAGAAAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051385065_1051385066 5 Left 1051385065 9:16498991-16499013 CCGTTTTATTAGTTAACACAATT 0: 1
1: 0
2: 1
3: 43
4: 513
Right 1051385066 9:16499019-16499041 ACCTGCCATAAGAAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051385066 Original CRISPR ACCTGCCATAAGAAAAGCAC AGG Intronic
No off target data available for this crispr