ID: 1051388930

View in Genome Browser
Species Human (GRCh38)
Location 9:16542382-16542404
Sequence AGAGAGAAGAAGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051388922_1051388930 23 Left 1051388922 9:16542336-16542358 CCCTATCTCAAGTCTACCTTGAC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG No data
1051388923_1051388930 22 Left 1051388923 9:16542337-16542359 CCTATCTCAAGTCTACCTTGACT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG No data
1051388921_1051388930 24 Left 1051388921 9:16542335-16542357 CCCCTATCTCAAGTCTACCTTGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG No data
1051388924_1051388930 7 Left 1051388924 9:16542352-16542374 CCTTGACTGAAAAAAAGAGAGAA 0: 1
1: 3
2: 27
3: 403
4: 3618
Right 1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051388930 Original CRISPR AGAGAGAAGAAGATGGGGGA GGG Intronic
No off target data available for this crispr