ID: 1051394189

View in Genome Browser
Species Human (GRCh38)
Location 9:16601598-16601620
Sequence CAGGCTCAGGAGTGTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 206}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051394189_1051394201 17 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394201 9:16601638-16601660 AAGAGGAAGCCAGGGAGGGCAGG No data
1051394189_1051394200 13 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394200 9:16601634-16601656 GGGGAAGAGGAAGCCAGGGAGGG No data
1051394189_1051394202 18 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394202 9:16601639-16601661 AGAGGAAGCCAGGGAGGGCAGGG No data
1051394189_1051394197 8 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394197 9:16601629-16601651 GGAGAGGGGAAGAGGAAGCCAGG No data
1051394189_1051394192 -8 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394192 9:16601613-16601635 TGAGCCTGAAAATGATGGAGAGG No data
1051394189_1051394204 24 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394204 9:16601645-16601667 AGCCAGGGAGGGCAGGGTCTGGG No data
1051394189_1051394203 23 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394203 9:16601644-16601666 AAGCCAGGGAGGGCAGGGTCTGG No data
1051394189_1051394196 0 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394196 9:16601621-16601643 AAAATGATGGAGAGGGGAAGAGG No data
1051394189_1051394194 -6 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394194 9:16601615-16601637 AGCCTGAAAATGATGGAGAGGGG No data
1051394189_1051394198 9 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394198 9:16601630-16601652 GAGAGGGGAAGAGGAAGCCAGGG No data
1051394189_1051394193 -7 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394193 9:16601614-16601636 GAGCCTGAAAATGATGGAGAGGG No data
1051394189_1051394199 12 Left 1051394189 9:16601598-16601620 CCTACTACACACTCCTGAGCCTG 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1051394199 9:16601633-16601655 AGGGGAAGAGGAAGCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051394189 Original CRISPR CAGGCTCAGGAGTGTGTAGT AGG (reversed) Intronic
900501690 1:3008899-3008921 CAGGCTCAGGACTGTGCACCAGG + Intergenic
900970718 1:5991431-5991453 CAGCCTCTCGCGTGTGTAGTTGG - Intronic
901230552 1:7639657-7639679 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
902558935 1:17264895-17264917 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
903161075 1:21489555-21489577 CAGCCTCAGCAGAGTGTCGTGGG - Intergenic
904907988 1:33912415-33912437 CAGCCTCAGGAGTGTGTGTGGGG - Intronic
905389323 1:37626149-37626171 CAGGCTGAGGAGTTTGGACTTGG - Intronic
906712861 1:47944603-47944625 CAGGCTGAGAAATGTGTAGAGGG - Intronic
907177491 1:52538533-52538555 CAGTCTCAGGAGGCTGAAGTGGG + Intronic
907328628 1:53657206-53657228 GAGGCTCAGGTGTATGTAATGGG + Intronic
910523114 1:88146088-88146110 AAGGCTCAGGAGTATGAAGAGGG - Intergenic
910772446 1:90843812-90843834 AGGGCTCAGCAGTGTGGAGTAGG - Intergenic
912672953 1:111648486-111648508 CAGGCCCAGGAGTGAGTACGAGG - Intronic
916427155 1:164691558-164691580 CAGCCTCAGGTGTGTCTAGATGG - Intronic
916641946 1:166739207-166739229 CAGTCTTAGGAGTGTGGGGTGGG - Intergenic
919356996 1:196536888-196536910 CAGGCTCATGAGAGTGTGGCAGG - Intronic
919541483 1:198851126-198851148 CAGCCTCCTGAGTGAGTAGTTGG - Intergenic
919880302 1:201896612-201896634 CAGGCACAGGGGGGTGCAGTGGG + Exonic
920870403 1:209789517-209789539 CAGACTCAGGTTTGTGCAGTAGG - Intronic
922119703 1:222652696-222652718 CATGATCAGGAGTGTGGACTTGG + Intronic
922211246 1:223488412-223488434 CAGGCTCTGGAGCATGTGGTTGG + Intergenic
923931658 1:238705823-238705845 GAGTCTCATAAGTGTGTAGTGGG + Intergenic
1063346314 10:5315307-5315329 CAGGGTCTGGGGTGTGTGGTTGG + Intergenic
1067682072 10:48447690-48447712 CAGGGTCATCAGCGTGTAGTTGG - Intronic
1070442776 10:76463095-76463117 GAGGCTCAGGGATGGGTAGTGGG + Intronic
1070530723 10:77335074-77335096 CAGGCACAGGAGTGTGGAGAAGG + Intronic
1073499552 10:103923493-103923515 CAGACTCAGGAGAGTGTTCTGGG - Intergenic
1073662302 10:105489872-105489894 TAGGAGGAGGAGTGTGTAGTTGG + Intergenic
1075004148 10:118818478-118818500 CTGGCGCAGGACTGTGTACTGGG + Intergenic
1077076433 11:704475-704497 CAGGCGCTGGTGTGTGAAGTGGG - Intronic
1079560425 11:21813359-21813381 CAGGCTCATGAGAGTGTAATGGG + Intergenic
1080646021 11:34188283-34188305 CAGTCCCAGGCATGTGTAGTAGG - Intronic
1083378312 11:62244019-62244041 CATGGTCAGGAGAGTGTCGTGGG - Intronic
1083807425 11:65083459-65083481 AAGGCTAAGGAGAGTGTTGTGGG - Intronic
1085170523 11:74445764-74445786 CAGGCTTAGGAATTTGTAGAGGG + Intergenic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1087167044 11:95015276-95015298 CAGGCTCCCGAGTGAGTAGCTGG + Intergenic
1087377776 11:97366359-97366381 CAGCCTCAGGTGTGTCTAGAAGG - Intergenic
1090909508 11:131106168-131106190 CAGGCTCAGCACACTGTAGTTGG + Intergenic
1091271454 11:134314416-134314438 CAGGCTCAGGAAGGTGTCCTTGG - Exonic
1091694745 12:2620708-2620730 CATGCAGATGAGTGTGTAGTAGG - Intronic
1094740161 12:33279822-33279844 CAGGCTCAGAAGTCTGAAATAGG - Intergenic
1096492364 12:52019652-52019674 CAGGCTCGGGGGTGGGCAGTGGG + Intergenic
1096575114 12:52548000-52548022 CAGAGTCATGAGTGTGTCGTGGG + Intronic
1096687333 12:53297102-53297124 CAGGAATAGTAGTGTGTAGTAGG + Intronic
1097029796 12:56082172-56082194 CTGGCTCAGGAATCTATAGTTGG - Intronic
1100874258 12:98945599-98945621 CAGACTCAGGAGTTTGTAAATGG - Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1102960719 12:117091706-117091728 CAAGCTCAGTAGTGGGCAGTGGG - Intronic
1105733499 13:23244697-23244719 CAGCCTTAGGAGTATGTTGTGGG + Intronic
1113058719 13:106298164-106298186 CAGCCTCACAAATGTGTAGTGGG - Intergenic
1114692971 14:24602018-24602040 CAGGCATAGGAGTGTGTTCTGGG - Intergenic
1117083682 14:52177898-52177920 CAGGCACTGGTGTGTGTATTAGG + Intergenic
1121797934 14:96751068-96751090 CGGGGTCAGGAGTCTGAAGTTGG + Intergenic
1122258438 14:100498110-100498132 CAGTTTCAGGAGTGTGTTGATGG + Intronic
1123018389 14:105386308-105386330 CAGGCTCTGCAGTGTGTAGGGGG - Intronic
1124620727 15:31272481-31272503 CAGGCTGAGGAGTTTGGACTTGG + Intergenic
1125727761 15:41876800-41876822 CAGGCTCACGTGTGTGCAGCTGG + Exonic
1125982102 15:44011808-44011830 GAGGCTCAAGAGGGTGTAGGAGG + Intronic
1127693966 15:61425850-61425872 CAGGGTGAGGAGTGTGTAATTGG - Intergenic
1127815434 15:62604610-62604632 CAGGTTCAGGAGGGTGTTGGTGG + Intronic
1128080066 15:64851802-64851824 CAGGCAGAGGAGGGTGTATTCGG + Intronic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1130921470 15:88348815-88348837 CAGCCTCTTGTGTGTGTAGTAGG - Intergenic
1132890620 16:2202622-2202644 CAGGCCCAGGAGTCTGGAGAGGG + Intergenic
1133414535 16:5596080-5596102 CAGGCTCAGGGATGTGGAGAGGG + Intergenic
1134301582 16:12996417-12996439 CAGGCTCAGGAGGGTGTTCTGGG - Intronic
1134853110 16:17498182-17498204 CAGGCTCAGGGGTATGTATCAGG - Intergenic
1135868830 16:26130071-26130093 CAGGACCAGGAGAGTGCAGTGGG + Intronic
1136248014 16:28986174-28986196 CTGGCTCAGGGGTGGGTAGGAGG - Exonic
1139614743 16:68082165-68082187 CAGGCTGAGGAGTTTGGACTTGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1141049272 16:80745932-80745954 CAGTCACAGGGCTGTGTAGTTGG - Intronic
1141068576 16:80933231-80933253 CAGCCTCAAGAGTAAGTAGTTGG - Intergenic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143403446 17:6660472-6660494 CAGGCTAAGGAGCATGAAGTGGG + Intergenic
1144046838 17:11461645-11461667 CAGGCTTAGGATTGGCTAGTTGG + Intronic
1144699181 17:17325679-17325701 CATGCTCAGGAGGGTGTATGTGG - Intronic
1150322829 17:64230695-64230717 CAGGCTCAGGGAGGTGAAGTGGG - Intronic
1153566271 18:6421033-6421055 CAGGCTCAGGAGGCTGATGTGGG - Intergenic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1157475235 18:48019811-48019833 CAGGCTCAGGCAGGTGCAGTGGG - Intergenic
1160451392 18:78968731-78968753 CAGGCTCAGGAGGGTGTGGGAGG - Intergenic
1160767499 19:814960-814982 CGTGCCCAGGAGAGTGTAGTTGG + Exonic
1161263933 19:3354269-3354291 ATGGCTCAGGAGTCTGAAGTGGG + Intergenic
1161322772 19:3648948-3648970 CAGGCACACGTGTGTGTAGGGGG - Intronic
1162511332 19:11120559-11120581 GAGGCTCAGGAGGGGGCAGTTGG - Intronic
1166040308 19:40198363-40198385 CAGGATCAGGACTGTGGGGTGGG - Exonic
1166407493 19:42531508-42531530 CTGGCTCAGGTGTGTGGAGGAGG + Intronic
1166580902 19:43898365-43898387 CATCCTCATGAGTGTGAAGTGGG - Intronic
1167113165 19:47473714-47473736 CAGGCCCAGGCGTGGGAAGTTGG - Intergenic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926231288 2:11005944-11005966 TAGCCTCAGCAGTGTGTGGTAGG + Intergenic
926633211 2:15156325-15156347 CAGGCACAGGAGTGTGAGGTTGG + Intergenic
929785549 2:44988264-44988286 CAGGATCAGGAGTGAGGGGTGGG + Intergenic
930637586 2:53822994-53823016 CATGCTCTTGAGTGTGCAGTGGG - Intergenic
931972712 2:67607217-67607239 CAGGGTCAAGAGTTTGCAGTTGG - Intergenic
932633613 2:73368779-73368801 CAGGCTCTGGGGTGTATTGTAGG - Intergenic
932836470 2:75042645-75042667 TGGGGTCAGGAGTGTGGAGTGGG - Intergenic
935870312 2:107441062-107441084 AGGGCTCAGGAGAGTGTGGTTGG + Intergenic
936144073 2:109967492-109967514 CAGGTACAGGAGTCTGGAGTTGG + Intergenic
936180755 2:110265453-110265475 CAGGTACAGGAGTCTGGAGTTGG + Intergenic
936200614 2:110403977-110403999 CAGGTACAGGAGTCTGGAGTTGG - Intronic
938271503 2:129976054-129976076 GAGGCTCAGGAGCCTGCAGTGGG - Intergenic
938783080 2:134602894-134602916 TAGACTCAGGAGTGTGTAAGTGG - Intronic
939983996 2:148812621-148812643 CTGGGTCAGGAGTGTGGAGCAGG + Intergenic
944676667 2:202038675-202038697 AAGGCTTAGGGGTATGTAGTGGG - Intergenic
946296021 2:218783978-218784000 CAGGCTGTGGTGTGTGTAGTAGG + Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948751161 2:240134147-240134169 CAGACACAGGAATGTGTATTGGG + Intronic
1169044048 20:2521559-2521581 TAGACTCAGGTGTGGGTAGTGGG + Intronic
1170435820 20:16327547-16327569 GGGGCTCAGGAGTGTGTAATTGG - Intronic
1172878091 20:38178290-38178312 CAGGCTCTGGAGAGTGTGGAGGG + Intergenic
1173352487 20:42257658-42257680 CAGGATCAAGAGAGAGTAGTGGG - Intronic
1173430548 20:42983618-42983640 TTGTCTCAGGAGTGTGAAGTGGG - Intronic
1174406629 20:50307038-50307060 CAGGCTCAGGAGCTGGGAGTGGG + Intergenic
1174947489 20:55004171-55004193 CAGTCTCTGGTGTGTGTATTTGG - Intergenic
1175304377 20:57965822-57965844 TAGGCTCAGGAGTGGGCAATTGG + Intergenic
1175785376 20:61708607-61708629 CAGGCACAGGAGGGTGGAGAGGG - Intronic
1175803357 20:61813618-61813640 CTGGCTCAGGGCTGTGTAATGGG + Intronic
1177180673 21:17741608-17741630 CAGGCTAAGGTGTGAGTAGGCGG + Intergenic
1181489730 22:23254042-23254064 CATGCTCAGGGGTATGTAGCAGG + Intronic
1182476107 22:30577152-30577174 CAGGCTGAGGTATGTGTAGAAGG + Intronic
1182666593 22:31964657-31964679 CAGGGTCATGTGTGTGTGGTGGG + Intergenic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1185337355 22:50276565-50276587 CAGGCTCAGCATGGGGTAGTGGG + Intronic
950879781 3:16313961-16313983 GAGGCTCAGGAGAGGGTAGTGGG - Intronic
951033951 3:17912647-17912669 GAGGCGCAGGGGAGTGTAGTGGG + Intronic
951430873 3:22605567-22605589 CAGGTACAGGAGAGTTTAGTTGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953718586 3:45336239-45336261 CTGGCACAGGACTGTGGAGTAGG + Intergenic
954687116 3:52377021-52377043 CTGTCTCAGGAGAGTGTGGTTGG - Intronic
955377465 3:58410202-58410224 CAGGATCAGGAGTCTCTAGTTGG + Intronic
960544016 3:118891337-118891359 CAGGATCAGCACTGTGAAGTTGG + Intergenic
965904247 3:173683405-173683427 CAGGCTGAGGAGAGCTTAGTGGG - Intronic
967216908 3:187218872-187218894 GAGGCTCAGGGGTGAGGAGTCGG + Intronic
968632331 4:1658522-1658544 CAGGCTCTGGAGTGTGGTGCTGG + Intronic
969098393 4:4751300-4751322 CAGACTCAGAGGTGTGTGGTGGG + Intergenic
971965879 4:33555169-33555191 TAGTCCCAGGGGTGTGTAGTGGG - Intergenic
972333822 4:38087725-38087747 CAGACTCCCGAGTGAGTAGTTGG - Intronic
972848959 4:43024734-43024756 CAGGCAGAGGGGTGTTTAGTAGG + Intronic
972992670 4:44841080-44841102 CAGTCTCAGGACAGTGTAGGGGG + Intergenic
975827185 4:78332060-78332082 CAGGCTTAGGATTGGCTAGTTGG + Intronic
976862677 4:89685176-89685198 CAGTCTGAGGACTGTGTAGAAGG + Intergenic
978437991 4:108706590-108706612 CAGACTCAGGACTGTGGACTTGG - Intergenic
979213548 4:118135255-118135277 CAGGCTTAGGAAGGGGTAGTGGG + Intronic
985647870 5:1093584-1093606 CTGGCTCAGGTTGGTGTAGTTGG + Exonic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
986348029 5:6852640-6852662 CAGGCCCAGGTGAGTGTAGGTGG + Intergenic
988356861 5:30187789-30187811 CAGGCAAAGGAGTGTGTACAGGG - Intergenic
991433282 5:66569951-66569973 CAGACAAAGGAGTGTCTAGTGGG - Intergenic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
993060798 5:83036500-83036522 CTGCCTCAGCAGTGTGTAGAAGG + Intergenic
997206082 5:132051006-132051028 CAGGGTCAGGAGTGAGTGGCAGG - Intergenic
997231831 5:132251158-132251180 CAGGATCAGCAGTGTGGAGTTGG - Intronic
998054864 5:139065780-139065802 AAGACTCAGGAGTGTATAGTGGG - Intronic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
998135814 5:139673957-139673979 GAGGGTCAGGGGTGTGGAGTCGG + Intronic
1000233083 5:159333297-159333319 CAGGGTCTGGATTGTGAAGTGGG - Intergenic
1001549927 5:172595401-172595423 CAGGCTTAGGATTGACTAGTTGG + Intergenic
1001667156 5:173442803-173442825 CAGGCTCAGGGGGAGGTAGTAGG + Intergenic
1003684586 6:8288644-8288666 CATGCTCATGGGTGTGTAGTGGG + Intergenic
1003982624 6:11403756-11403778 CAAGCTCAGGACTGTGCTGTAGG + Intergenic
1005661384 6:28002412-28002434 CAGGCTCATGAGAGCATAGTAGG + Intergenic
1005816133 6:29554152-29554174 CAGGCTGGGCAGTGAGTAGTTGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007269086 6:40622038-40622060 CGGCCTATGGAGTGTGTAGTGGG - Intergenic
1012977930 6:105800034-105800056 CAGAGTCAGGAGAGTGGAGTTGG - Intergenic
1013819911 6:114142441-114142463 CAGGCTCACGAGTGAGTCATGGG + Intronic
1014072285 6:117196784-117196806 AATGCTCAAGAGTGTGGAGTGGG - Intergenic
1015515688 6:134080586-134080608 AAGGCACAGGTGTGTGTAGTGGG - Intergenic
1016342038 6:143073032-143073054 CAGGCACGGGAGTGGGAAGTGGG - Intronic
1016396978 6:143634700-143634722 CAGGCTGATGACTTTGTAGTTGG + Intronic
1017670162 6:156762938-156762960 CAGGCTCAGGAGAATAGAGTAGG + Intergenic
1017721276 6:157244946-157244968 CAGGCTCAGGTGGGTTTAGGGGG + Intergenic
1018814856 6:167322976-167322998 CAGGCTCAGTAGAGGGTAGAAGG + Intergenic
1018842317 6:167526291-167526313 CAGGCTCAGGGGTGAGGTGTGGG - Intergenic
1019628024 7:2031189-2031211 CAGGCAGAGGGGTGAGTAGTGGG - Intronic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020748018 7:12102299-12102321 CAGCCTCAGGAGACTGAAGTGGG + Intergenic
1024637234 7:51300924-51300946 CTGGGTCAGGAGTGTGCACTGGG + Intronic
1024700171 7:51898436-51898458 CCTGCTCAGGAGAGTGCAGTGGG - Intergenic
1025159512 7:56642354-56642376 CATGCTCAAAAGTGTGTTGTTGG - Intergenic
1025756225 7:64345428-64345450 CATGCTCAAAAGTGTGTTGTTGG + Intronic
1026361520 7:69605246-69605268 CAGGCACAGAAGCTTGTAGTCGG + Intronic
1029091113 7:98049219-98049241 TAGGCTCAGGAGTGAGTAACTGG - Intergenic
1032877496 7:136053238-136053260 TAGACTCAGCAGTGTGGAGTGGG - Intergenic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1034369727 7:150584412-150584434 CAGGCCCAGGAGTTGGTAATTGG + Intergenic
1038685982 8:29718945-29718967 GAGGCTCAGAAGTGTGCTGTGGG + Intergenic
1039436751 8:37564600-37564622 AAGCCACAGGAGTGTGCAGTAGG - Intergenic
1041723460 8:60997159-60997181 AAGGCTCAGGTGTGTGTGGCGGG + Intergenic
1044283415 8:90383142-90383164 CAGTCTCTAGAGTGTTTAGTGGG - Intergenic
1049115914 8:140687555-140687577 CAGGCTCAGGTGTGGGAAATAGG - Intronic
1049642971 8:143723664-143723686 CAGGCTGGGCAGTGTGTGGTGGG + Intergenic
1049709827 8:144058455-144058477 CAGGCCCAGGAGTGGGCAGTGGG + Intronic
1050640207 9:7659468-7659490 CATGCTGAGGAGTGGGCAGTTGG + Intergenic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1051734812 9:20187417-20187439 CAGGCTCAGAAGTTTGGACTTGG - Intergenic
1053576138 9:39358383-39358405 GAGGATCAGGGGTGTGTGGTGGG - Exonic
1053840655 9:42186320-42186342 GAGGATCAGGGGTGTGTGGTGGG - Exonic
1054097711 9:60917074-60917096 GAGGATCAGGGGTGTGTGGTGGG - Intergenic
1054119113 9:61192704-61192726 GAGGATCAGGGGTGTGTGGTGGG - Exonic
1054588640 9:66989858-66989880 GAGGATCAGGGGTGTGTGGTGGG + Intergenic
1055986665 9:82061024-82061046 GAGGATCAGGGGTGTGTGGTGGG + Intergenic
1056584737 9:87920561-87920583 GAGGATCAGGGGTGTGTGGTGGG - Intergenic
1056612138 9:88132379-88132401 GAGGATCAGGAGTGCGTGGTGGG + Intergenic
1057160511 9:92885191-92885213 GAGGATCAGGAGTGCGTGGTGGG - Intergenic
1057164723 9:92916564-92916586 CAGGCTAAGGAGTGTGATGTGGG + Intergenic
1060559547 9:124531537-124531559 CAGGCTGTGGAGTCTGTAATTGG - Intronic
1060984009 9:127809605-127809627 CGGGCTCAGGAGTGTGTGTGCGG + Intronic
1061930485 9:133830280-133830302 CAGGCACAGGAGTGAGGAGAAGG - Intronic
1061932487 9:133840412-133840434 CAGGGGCAGGAGTGGGGAGTGGG - Intronic
1189693233 X:43638292-43638314 CAGGCTGAGGAGAGTGTGATAGG + Intergenic
1190326984 X:49212607-49212629 CAGGCTGAGAAGTGTGAAATGGG + Intronic
1192216644 X:69164007-69164029 CAGGCAGAGGAGTGTATGGTTGG + Intronic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1196003879 X:110814794-110814816 CAGGTTCAAGAGAGTGTAGGAGG + Intergenic
1197342681 X:125292192-125292214 CAGGCTATGGAGTATGGAGTGGG + Intergenic
1198045115 X:132893820-132893842 TAGGCTCAGGATTGTGTATTGGG - Intronic
1198371075 X:135989834-135989856 GAGGGTCAGGAATGTGTAGGAGG + Intronic
1198594302 X:138219480-138219502 CAGGCTAAGGAATGTATAGAGGG + Intergenic
1202344586 Y:23908073-23908095 CATGCTCAGGAGGCTGAAGTGGG + Intergenic
1202526182 Y:25762010-25762032 CATGCTCAGGAGGCTGAAGTGGG - Intergenic