ID: 1051397015

View in Genome Browser
Species Human (GRCh38)
Location 9:16634150-16634172
Sequence CACAGTGGACAAATTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051397015_1051397018 -4 Left 1051397015 9:16634150-16634172 CCAATTGCAATTTGTCCACTGTG 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1051397018 9:16634169-16634191 TGTGCAAATTCAATGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051397015 Original CRISPR CACAGTGGACAAATTGCAAT TGG (reversed) Intronic
901884417 1:12212753-12212775 CACAGTGGTCCAACTGCTATGGG + Intergenic
904046255 1:27610576-27610598 CACAGTCAACAATTTGCAAATGG + Intergenic
905458988 1:38108676-38108698 CACAGTTGACAAATTAGGATGGG + Intergenic
906177551 1:43788292-43788314 CAAAGAAGATAAATTGCAATTGG + Intronic
908746119 1:67378153-67378175 CAAAATAGACAAATTTCAATAGG - Intronic
911959103 1:104276544-104276566 CACAGTTGACTAATTACATTAGG - Intergenic
915153496 1:153854771-153854793 CACAGACGACTAATTGCAAAAGG + Intronic
916615467 1:166434746-166434768 CCCAGTGGATAAATGGCATTTGG - Intergenic
916823920 1:168426442-168426464 CAAAGGGGACAATTTGCATTTGG + Intergenic
918010630 1:180583285-180583307 GACAGAGTATAAATTGCAATTGG - Intergenic
924299356 1:242621676-242621698 CACTGTGGACAGACAGCAATGGG - Intergenic
1063771130 10:9202170-9202192 CACAGTGGAAAAATTAAAATTGG + Intergenic
1064200551 10:13281116-13281138 CAAAGTGAACAAATTGATATTGG + Intronic
1073614525 10:104979991-104980013 CACAGGAGACATATTGCATTTGG - Intronic
1075673471 10:124280203-124280225 TGCAGAGGACAAGTTGCAATTGG + Intergenic
1076772011 10:132670907-132670929 CAAAGTGGAGAAACTGCAAACGG + Intronic
1077656664 11:4025941-4025963 CACAGTGAGCAAATTCTAATAGG - Intronic
1079010868 11:16827089-16827111 CCAAATGGACAAATTGCAAAAGG - Intronic
1080448543 11:32359455-32359477 CACAGTGAATAAAGTGCTATGGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1084804444 11:71569234-71569256 CCCAATAGACAAATTGCAACAGG - Intergenic
1085404235 11:76252389-76252411 CACAGTGGAGAAATTCTTATGGG + Intergenic
1089078364 11:115757111-115757133 CACAGGGGAAAAATGGAAATGGG - Intergenic
1090197351 11:124827971-124827993 CACAGTGAACAAAGTGCACGGGG + Intergenic
1090429014 11:126630459-126630481 CATAGTGAACAAATAGCAAAAGG - Intronic
1092849372 12:12612672-12612694 CACACTGGCCAAATAGCAACAGG - Intronic
1092930450 12:13310500-13310522 CACAGAAGATACATTGCAATTGG - Intergenic
1093127013 12:15342840-15342862 CACAGCTGACAAACTGCAATGGG - Intronic
1094309123 12:29058384-29058406 CACAGTGAAGAAATTGAACTTGG + Intergenic
1094471023 12:30801537-30801559 CAAACTGAACAAACTGCAATAGG + Intergenic
1094774452 12:33708114-33708136 CACAGTGGAGAAAATGTAACTGG + Intergenic
1097506879 12:60484567-60484589 AACAGAGGCCAAATTGCAATTGG + Intergenic
1097638608 12:62151646-62151668 AACAGTGGAAAAATTACAGTTGG - Intronic
1098649276 12:72943837-72943859 CACAGTGAAAAAATTACAAAGGG - Intergenic
1100055265 12:90501726-90501748 CACAGTGGTCCAAATGCATTGGG + Intergenic
1100144056 12:91655456-91655478 CACAATGACCAAATTACAATGGG + Intergenic
1104052709 12:125206896-125206918 AACAGTGGTGAAAATGCAATTGG + Intronic
1105595409 13:21833298-21833320 CACAGTGGAAAAATAGACATGGG + Intergenic
1108232943 13:48369517-48369539 CACTGTATACCAATTGCAATGGG - Intronic
1108676507 13:52741449-52741471 CACAGAAGACACATTGCAAAGGG + Intergenic
1111663574 13:91240660-91240682 TCCAGTTGACAAATTGCAACCGG - Intergenic
1112598726 13:100833721-100833743 CAAAGTGGACACTTGGCAATGGG - Intergenic
1113314691 13:109166132-109166154 CCCTGTGGACATATTGCAATTGG - Intronic
1114695785 14:24626548-24626570 GACAGTGGAAAACTTGCATTTGG - Intergenic
1116679963 14:47954688-47954710 CACAGTGACCAAATTGCATAAGG + Intergenic
1120011369 14:79419332-79419354 CAAAATGGATGAATTGCAATAGG + Intronic
1202829167 14_GL000009v2_random:7515-7537 CACAGTTGAGAATTTGAAATTGG + Intergenic
1202900883 14_GL000194v1_random:37367-37389 CACAGTTGAGAATTTGAAATTGG + Intergenic
1124600566 15:31129818-31129840 CACTGTGGACCAATGGCCATGGG + Intronic
1126810668 15:52400272-52400294 AACAGAGGATAAATTGGAATGGG - Intronic
1129016372 15:72472913-72472935 CAAAATGGACAAATTGGAAGAGG + Intergenic
1135248064 16:20874365-20874387 AACGGTGTAAAAATTGCAATTGG - Intronic
1138653050 16:58472662-58472684 CACAGTGGACACAGGGCCATCGG + Intronic
1138774665 16:59706816-59706838 AAAGGTGGACAATTTGCAATAGG + Intergenic
1140514656 16:75533207-75533229 CACAGTGGACAATTGGCCAAGGG + Intronic
1141854991 16:86674676-86674698 CACAGGGGACAAACTCCAAGCGG - Intergenic
1141886950 16:86898804-86898826 CACATTGGAGAAATTGCAGTGGG + Intergenic
1145068234 17:19779182-19779204 CACAGTAGACAAATAGAAAATGG + Intronic
1148825679 17:50392262-50392284 CATAGTGGACATATTTCACTCGG + Intronic
1155018207 18:21867804-21867826 CAGAGTGGACAAACAGCAATTGG - Exonic
1155378660 18:25191460-25191482 CATAGTGAGCAAATTGCAAGCGG - Intronic
1157227577 18:45880876-45880898 CACACTGGACATATTGTAACTGG - Intronic
1158665613 18:59430023-59430045 CACAGTGCCCAGATTGCAATAGG + Intergenic
1159624658 18:70678509-70678531 TACAGTGAACAAATTTTAATTGG + Intergenic
1159796335 18:72848620-72848642 TACAGTTGACAAATTCCAGTTGG + Intronic
1164205727 19:23057022-23057044 CCCATAGGAGAAATTGCAATGGG + Intergenic
1202643529 1_KI270706v1_random:120274-120296 CACAGTTGAGAATTTGAAATTGG - Intergenic
926277973 2:11419804-11419826 CACAGTGGACAAATCTGAAAGGG - Intergenic
928780551 2:34812943-34812965 CTCAGCAGACAAATTGTAATGGG - Intergenic
928909363 2:36403222-36403244 CACAGTGAACATTTTGCAAAAGG + Intronic
930755936 2:54972772-54972794 CACAGTGCACAAACTGAAAAGGG + Exonic
933192344 2:79348952-79348974 GCCAGAGAACAAATTGCAATCGG + Intronic
934505905 2:94893841-94893863 CACAGTTGAGAATTTGAAATTGG - Intergenic
937756397 2:125543795-125543817 CACAGTCTACAAATTTGAATGGG - Intergenic
940435877 2:153653561-153653583 GACAAGGGCCAAATTGCAATTGG + Intergenic
944633588 2:201653006-201653028 CACAGATGACAAACTGGAATAGG - Intronic
946140540 2:217686943-217686965 CACAGTGGACAATTTGGGAAGGG - Intronic
1168953794 20:1820159-1820181 CACAGTGGAGAACTTGTGATGGG - Intergenic
1169199645 20:3702181-3702203 CACAGTTCACATATTGCATTGGG - Intronic
1169290013 20:4341467-4341489 CACAGTGGAGAAAGTGGATTTGG + Intergenic
1170615586 20:17946809-17946831 CACAGTGGAGAAACTGGATTTGG + Intronic
1171893493 20:30739213-30739235 CACAGTTGAGAATTTGAAATTGG - Intergenic
1174641327 20:52046957-52046979 CACACTAAACAAATTGCTATGGG + Intergenic
1176608351 21:8852354-8852376 CACAGTTGAGAATTTGAAATTGG + Intergenic
1176620257 21:9052145-9052167 CACAGTTGAGAATTTGAAATTGG + Intergenic
1180358437 22:11862159-11862181 CACAGTTGAGAATTTGAAATTGG + Intergenic
1180379825 22:12130171-12130193 CACAGTTGAGAATTTGAAATTGG - Intergenic
950209628 3:11112663-11112685 GACAGTGGATAAACTACAATGGG - Intergenic
956930196 3:74034836-74034858 TACAGAAGACAAAATGCAATCGG - Intergenic
960284243 3:115809594-115809616 CACAGTGGAGAAAATGAAAATGG + Exonic
961601766 3:128067948-128067970 CACAGGGGAGAAGTTGGAATTGG - Intronic
965366675 3:167809289-167809311 CATACTGGCCAAATTCCAATTGG + Intronic
966177774 3:177157786-177157808 CAAAGGGGACTAACTGCAATTGG + Intronic
966437460 3:179904758-179904780 CACAGTGGACACAGTGCATAGGG - Intronic
968044992 3:195619016-195619038 CACAATGGACATATTGACATTGG + Intergenic
968060776 3:195725068-195725090 CACAATGGACATATTGACATTGG + Exonic
970459523 4:16258884-16258906 AACAGTGGAAAAGTTGGAATTGG + Intergenic
971491650 4:27218686-27218708 TACAGTCAACAAATTACAATTGG - Intergenic
975066232 4:70067376-70067398 CACAGTGGAAAATCTGCAGTGGG - Intergenic
975608410 4:76179594-76179616 CACAGTTGACGAATTGCTCTGGG - Exonic
978747926 4:112215246-112215268 CACATTGGCCAAATTACAAAAGG + Intergenic
979942960 4:126785561-126785583 CACACTGGAAAAATTGTCATGGG + Intergenic
1202770897 4_GL000008v2_random:206188-206210 CACAGTTGAGAATTTGAAATTGG - Intergenic
988540641 5:32105636-32105658 CACAGTGCACAATCTGCATTTGG - Intronic
988712094 5:33788916-33788938 CACTGTGGAAAAATTGCTGTGGG - Intronic
991343531 5:65638532-65638554 AACAGTGAACAAATTTCACTTGG + Intronic
992563453 5:77974502-77974524 CAAAATGAACAAATTGCAAGTGG + Intergenic
995011890 5:107265603-107265625 CAGAGTAGACAAGTTGAAATGGG - Intergenic
995955058 5:117767579-117767601 CACAGCAGACATATTCCAATTGG - Intergenic
996860795 5:128063583-128063605 CACAGTTGATAAATAGCAAATGG + Intergenic
1002653030 5:180717637-180717659 GACAGTGGCGAATTTGCAATGGG + Intergenic
1003962293 6:11220054-11220076 CACAGTCGACAAATAGTACTGGG - Intronic
1004349512 6:14878837-14878859 CACAGTTGAGAAATTGAATTGGG - Intergenic
1006014645 6:31070625-31070647 CCCAGTGGACAGACTGCAATGGG + Intergenic
1008214770 6:48775192-48775214 CACAAAGTACAAATTGCAATTGG + Intergenic
1013970046 6:116006183-116006205 CACAGTAGAAAAATTGGCATAGG + Intronic
1018724875 6:166604111-166604133 CACAGTGAAAAACTTTCAATTGG - Intronic
1021412476 7:20344045-20344067 CACATTGGACTAGTTGCTATGGG + Intronic
1022032774 7:26507328-26507350 CTCATTGGCCAAATTGCAATGGG + Intergenic
1025886531 7:65599585-65599607 CACAGTGCACACATTGCACATGG + Intergenic
1029067830 7:97870090-97870112 CACAGTTGAGAATTTGAAATTGG - Intronic
1029603081 7:101581341-101581363 CACAATGGATACATGGCAATGGG + Intergenic
1030653582 7:112141867-112141889 CAGAGTTGCCAGATTGCAATTGG + Intronic
1037788464 8:21917130-21917152 CACAGGGGACAACTTTCAAGAGG + Intergenic
1038943204 8:32328751-32328773 CACAGTGCACTAAATGCAGTAGG + Intronic
1039297344 8:36170653-36170675 CACTGTCGACAAATCCCAATAGG + Intergenic
1041465610 8:58155084-58155106 CACAGTGGCCAGAATGCATTGGG - Intronic
1041722153 8:60985452-60985474 CAGAGTGGACAAAGTCCATTTGG - Intergenic
1046712850 8:117531845-117531867 GACAGTGGACAAATGACAGTTGG + Intronic
1051397015 9:16634150-16634172 CACAGTGGACAAATTGCAATTGG - Intronic
1054355144 9:64053499-64053521 CACAGTTGAGAATTTGAAATTGG + Intergenic
1055909278 9:81328741-81328763 CACAGTTGACTAATGGCATTTGG + Intergenic
1058833133 9:108837289-108837311 CACAGTGGACAAGCAGAAATTGG - Intergenic
1061752048 9:132785718-132785740 CACTGTGGACAGAATGAAATTGG - Intronic
1203703752 Un_KI270742v1:17567-17589 CACAGTTGAGAATTTGAAATTGG + Intergenic
1203566642 Un_KI270744v1:96914-96936 CACAGTTGAGAATTTGAAATTGG - Intergenic
1186286468 X:8049180-8049202 AAGAGAGGACAATTTGCAATGGG - Intergenic
1189217140 X:39335986-39336008 CTCATTGGACAAACTGCTATGGG - Intergenic
1195529790 X:105940844-105940866 CACATTATATAAATTGCAATGGG + Intronic
1196393624 X:115235205-115235227 CACATTGCTCAAATTGAAATAGG - Intergenic
1197625672 X:128799605-128799627 AACAGTGGTGAAATGGCAATTGG + Intergenic