ID: 1051410386

View in Genome Browser
Species Human (GRCh38)
Location 9:16784195-16784217
Sequence GCTACATTGTGAGCAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051410386_1051410393 27 Left 1051410386 9:16784195-16784217 CCTGGAGTTGCTCACAATGTAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1051410393 9:16784245-16784267 TTAGGGTTCAGAGTATTCAGGGG No data
1051410386_1051410391 25 Left 1051410386 9:16784195-16784217 CCTGGAGTTGCTCACAATGTAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1051410391 9:16784243-16784265 AATTAGGGTTCAGAGTATTCAGG No data
1051410386_1051410392 26 Left 1051410386 9:16784195-16784217 CCTGGAGTTGCTCACAATGTAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1051410392 9:16784244-16784266 ATTAGGGTTCAGAGTATTCAGGG No data
1051410386_1051410389 9 Left 1051410386 9:16784195-16784217 CCTGGAGTTGCTCACAATGTAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1051410389 9:16784227-16784249 AGCTGTGCAAACAGATAATTAGG No data
1051410386_1051410390 10 Left 1051410386 9:16784195-16784217 CCTGGAGTTGCTCACAATGTAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1051410390 9:16784228-16784250 GCTGTGCAAACAGATAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051410386 Original CRISPR GCTACATTGTGAGCAACTCC AGG (reversed) Intronic
905888602 1:41505440-41505462 GCTACAATGTGAGCTCCTCGTGG + Intergenic
906561636 1:46762460-46762482 GCTACGTTGTGAGCAGCCCCAGG + Intronic
915399201 1:155610263-155610285 ACTGCAGTGTGAGCACCTCCCGG - Exonic
915416316 1:155745843-155745865 ACTGCAGTGTGAGCACCTCCCGG - Intergenic
916311412 1:163402667-163402689 GCTACAGTGTGAGCAAAGGCAGG + Intergenic
917040184 1:170797135-170797157 GCTACATTCTGAGATACTACTGG - Intergenic
921299285 1:213735237-213735259 GCAACATTGCCAGCAATTCCAGG - Intergenic
922070139 1:222184065-222184087 GGTAAATTGTGAGGAACTCAAGG - Intergenic
923480138 1:234376147-234376169 GATGCATTGAGAGGAACTCCAGG + Intronic
1069664695 10:70146518-70146540 GCTGCATGGTGAGCGCCTCCCGG - Exonic
1070666449 10:78348458-78348480 ACTACATTGTCAGCATCTCAAGG - Intergenic
1072800291 10:98388125-98388147 GCTAGACTGTGAGCAACTGGAGG + Intronic
1073081117 10:100861491-100861513 GCCAAAATGTGAGCATCTCCGGG - Intergenic
1074572405 10:114636022-114636044 GCTAGATGGTGAGCACCTCCTGG - Intronic
1074965223 10:118485084-118485106 GCTACACTGTGATCAGCTGCTGG - Intergenic
1076137431 10:128054794-128054816 TCTGCATTGTGAGCAAGCCCAGG + Intronic
1077618298 11:3695532-3695554 ACTGCATGGTGAGCAGCTCCCGG + Exonic
1080697695 11:34617323-34617345 CCTGCATTCTGAGCAAATCCTGG - Intergenic
1083792578 11:64995485-64995507 ACTACAATGTGAGCAATTTCAGG - Intronic
1087681826 11:101226825-101226847 TCCAGATTGAGAGCAACTCCTGG + Intergenic
1087829766 11:102807103-102807125 GCTACACTTTGAGGAAGTCCCGG - Intergenic
1087991386 11:104748152-104748174 GCTACACTCTGACCAACGCCAGG + Intergenic
1088466154 11:110140978-110141000 GTTAAATTGTGGACAACTCCTGG + Intronic
1089959037 11:122599585-122599607 GCTACACTGTGGGCATCTCCTGG - Intergenic
1099037433 12:77606502-77606524 GCTACAATGTGAGTAACTTCAGG + Intergenic
1100596569 12:96077397-96077419 GCCAACTTCTGAGCAACTCCGGG - Intergenic
1100638771 12:96461106-96461128 GGTACATTATGGGCCACTCCAGG - Intergenic
1100787989 12:98099051-98099073 GCATCATTGTAAGCTACTCCGGG + Intergenic
1101057801 12:100937158-100937180 GTTACATTGTGACCATCTTCAGG + Intronic
1105335118 13:19460095-19460117 GCTACAGTGTGTAAAACTCCTGG + Intronic
1112694184 13:101929124-101929146 GCTATATTCTGAGCCACTCAAGG - Intronic
1112706729 13:102078676-102078698 GCTACATTGTCTCCAACTGCTGG - Intronic
1117053821 14:51889692-51889714 TCTACATTGTGCTCAACACCTGG - Intronic
1120411299 14:84159778-84159800 GCTACATAGTCTGCAACTCCTGG + Intergenic
1129994623 15:79993860-79993882 ACTAGACTGTGAGCAACTCAAGG - Intergenic
1133789903 16:9001618-9001640 TCTACATTGTGTTGAACTCCTGG + Intergenic
1137723534 16:50641811-50641833 GCCACATTGTGAGGGTCTCCAGG - Intergenic
1139062697 16:63273939-63273961 GATACATTGTGAGCAAATGTTGG - Intergenic
1140435792 16:74945739-74945761 TCTACAGTGTGAGTCACTCCCGG + Intronic
1144057154 17:11553526-11553548 ACTACATTGTGAGCTGCTCAAGG - Intronic
1144225679 17:13143066-13143088 GATACATTTTGAGCAACTGTAGG + Intergenic
1144503949 17:15813892-15813914 GCTGCATTGTGAGCAATGGCAGG + Intergenic
1144633137 17:16885705-16885727 GCTGCATTGTGAGCAATGGCAGG + Intergenic
1145167804 17:20629394-20629416 GCTGCATTGTGAGCAATGGCAGG + Intergenic
1146107792 17:30057758-30057780 GCTCCAGTTTGTGCAACTCCTGG + Exonic
1146687340 17:34849870-34849892 GCTAGACTGTGAGCTGCTCCAGG - Intergenic
1147773636 17:42885009-42885031 GCTATATTGTGACCAACTGCTGG + Intergenic
1149364722 17:55931720-55931742 GCTACATTTTGTGAAACCCCAGG + Intergenic
1151180529 17:72324235-72324257 GCCACATTCTGAGCACCTGCAGG - Intergenic
1154030639 18:10750807-10750829 GATACATTGTGTGCATTTCCTGG + Intronic
1155432078 18:25769979-25770001 GCTTCATTATGAGGAACTGCAGG - Intergenic
1161125709 19:2556137-2556159 GGTTCATTGTGCGCAAGTCCCGG - Intronic
1166826947 19:45615821-45615843 GCTGCTTTGTCACCAACTCCGGG - Exonic
1168355900 19:55699505-55699527 GCTGCAGTTTGAGAAACTCCAGG - Intronic
925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG + Intergenic
927902319 2:26829426-26829448 GCTACTTTGGGGGCAGCTCCTGG - Intergenic
928070508 2:28210307-28210329 CCTAGATTGTGAGCAGCTCACGG - Intronic
928243908 2:29610890-29610912 AGTACAGTGTCAGCAACTCCAGG - Intronic
929642095 2:43591984-43592006 GTTACATTGTGTGCAACTCACGG - Exonic
931143115 2:59485489-59485511 ACTACACTGTGAGCAACTTGAGG - Intergenic
932128283 2:69164827-69164849 GCTCCATTGTCAGGAACTCTGGG - Intronic
932420962 2:71601119-71601141 GCCACAATGTGAGGGACTCCAGG + Intronic
936403834 2:112185332-112185354 TCTCCATTGTGAGTATCTCCAGG + Exonic
936903675 2:117512481-117512503 GCTACATTGTGAGCAATGGCTGG + Intergenic
942446485 2:176081913-176081935 GCTCCATTGTGCCCAACGCCTGG - Intronic
943290818 2:186068667-186068689 GCCACTTTGTGAGAAAGTCCAGG - Intergenic
945681392 2:212918172-212918194 GCTACATTTTAAAGAACTCCAGG - Intergenic
948480499 2:238247275-238247297 GCTACACTGTGAGGACATCCAGG + Intronic
948980735 2:241493327-241493349 GCTACAGCGTGAGCATCCCCAGG + Exonic
1172881399 20:38202234-38202256 GCAACACTGTGAGTAACCCCAGG - Intergenic
1183175808 22:36223941-36223963 GCTACACTGACACCAACTCCTGG + Intergenic
950152201 3:10696540-10696562 GCTACAGAGTCAGCAAGTCCAGG - Intronic
950226954 3:11243396-11243418 ACTAAATGGGGAGCAACTCCAGG - Intronic
950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG + Intronic
950692149 3:14667901-14667923 GCTTCATTGTGAGGATCTCAAGG + Intronic
952408660 3:33027259-33027281 GCTGCAGGGTGAGCAGCTCCAGG - Intronic
953078088 3:39589775-39589797 GATACATTGAGAGGAACTCATGG + Intergenic
960096282 3:113693305-113693327 CCTCCATGTTGAGCAACTCCAGG - Intronic
962669117 3:137686853-137686875 GCTATACTGTGAGCAACTGGAGG - Intergenic
966817034 3:183897746-183897768 GCTACAGAGTGAGCAAGTCTGGG - Intergenic
967635732 3:191801222-191801244 GCTTAATTGTGAGCAACCACAGG + Intergenic
967685050 3:192409016-192409038 GCTGCGGTGAGAGCAACTCCCGG + Exonic
970786458 4:19803245-19803267 GCCACATTGTGAGCTACTGGGGG + Intergenic
971931939 4:33096173-33096195 GCTACAGTCTGAGAAACTACAGG - Intergenic
973284825 4:48403501-48403523 GCTGCATTGTGGGGAACTCCTGG + Intronic
973635517 4:52858751-52858773 GCTGATTTGGGAGCAACTCCTGG + Intergenic
983935450 4:173499893-173499915 GCTCCATATTGAGCAACACCGGG + Intergenic
993671705 5:90768562-90768584 GCTACATTTTGAGAAAGTCCAGG - Intronic
993717699 5:91291827-91291849 GGTACCTGGTGAGCAATTCCTGG + Intergenic
995297603 5:110539047-110539069 GCTACAATGTAAGCATCACCTGG + Intronic
995739489 5:115340102-115340124 ACTAGATTGTGAGGAAGTCCTGG + Intergenic
1002660294 5:180787060-180787082 GCTGCATTGTGAGTAAAGCCTGG - Intergenic
1005486770 6:26307946-26307968 GCTGTATTGGGAGCAATTCCTGG - Intergenic
1006864806 6:37200692-37200714 CCTACCTTGTGAGCACCTCAAGG + Intergenic
1011702567 6:89969383-89969405 GATACATTGTGAGTTCCTCCAGG - Intronic
1021011825 7:15478521-15478543 GCCACATTGTGAGCACATGCTGG - Intronic
1021441649 7:20684425-20684447 GCCACAAAGTGAGAAACTCCTGG + Intronic
1023166785 7:37350704-37350726 GCTACATTCTGAGCTACTGGGGG - Intronic
1029367386 7:100125373-100125395 CCTAAATTATCAGCAACTCCAGG - Exonic
1033572096 7:142640427-142640449 GGTACAATGTGAAGAACTCCTGG + Intergenic
1034502101 7:151457332-151457354 GCTGCATTGTGTCCAAGTCCTGG - Intergenic
1037558177 8:20046921-20046943 ATCACATTGTGAGCAAATCCAGG - Intergenic
1037812259 8:22094142-22094164 GCAACATTCTTAGCACCTCCAGG + Intronic
1038911709 8:31972172-31972194 GGTAAATTGTGAGCAGCTCAAGG - Intronic
1041357015 8:57012092-57012114 GCTACATAATGAGAAACTCATGG - Intergenic
1043438579 8:80257208-80257230 GCTGCATTGTGATCAACTTGAGG - Intergenic
1051410386 9:16784195-16784217 GCTACATTGTGAGCAACTCCAGG - Intronic
1052884591 9:33632305-33632327 GGTACAATGTGAAGAACTCCTGG + Intergenic
1057915585 9:99052905-99052927 GCAACTTTGTAAGCATCTCCTGG + Intronic
1058464680 9:105215658-105215680 ACTACATTGTGAGCACCTTGTGG - Intergenic
1187008400 X:15254343-15254365 GCTACCATGTGAACAAGTCCAGG + Intronic
1195571649 X:106403695-106403717 GCAACATACTGAGCCACTCCTGG - Intergenic
1199280063 X:145991219-145991241 GCTACAATGTGAACACCTACGGG - Intergenic
1199676617 X:150194989-150195011 TCTAAATTGAGAGCAATTCCTGG - Intergenic