ID: 1051412789

View in Genome Browser
Species Human (GRCh38)
Location 9:16808439-16808461
Sequence ACTAGGATATTGATAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051412789_1051412790 -10 Left 1051412789 9:16808439-16808461 CCTGAATCTATCAATATCCTAGT 0: 1
1: 0
2: 0
3: 14
4: 256
Right 1051412790 9:16808452-16808474 ATATCCTAGTTGTGTGATCTTGG No data
1051412789_1051412791 -9 Left 1051412789 9:16808439-16808461 CCTGAATCTATCAATATCCTAGT 0: 1
1: 0
2: 0
3: 14
4: 256
Right 1051412791 9:16808453-16808475 TATCCTAGTTGTGTGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051412789 Original CRISPR ACTAGGATATTGATAGATTC AGG (reversed) Intronic
905023348 1:34833164-34833186 CCTAACATATTCATAGATTCTGG - Intronic
906354869 1:45096187-45096209 ATTAGGATATAGATAAATTGTGG + Intronic
907991299 1:59585549-59585571 TCTAGGATTTTTATAGTTTCAGG - Intronic
911466186 1:98255978-98256000 TTTAGGATATTTATAGATTCTGG - Intergenic
912104863 1:106259831-106259853 TCTAGAATATTTATAGTTTCAGG + Intergenic
912694807 1:111833260-111833282 ACTTGGATCTTGACAGATGCTGG + Intronic
914793183 1:150897626-150897648 AAAAGGATATTAATAGATACAGG + Intergenic
915028209 1:152853158-152853180 CCTAGGAAATTGAAAGATGCAGG - Intergenic
918412933 1:184279531-184279553 TCTAGGAGTTTGATAGTTTCAGG + Intergenic
918867214 1:189917658-189917680 TCTAGGATTTTTATAGTTTCAGG + Intergenic
918989618 1:191681908-191681930 TCTAGGATATTCATAGTTTTGGG + Intergenic
919276119 1:195418891-195418913 TCTAGGATTTTTATAGTTTCAGG + Intergenic
920042352 1:203109552-203109574 TCTAGGATATTTATAGTTTGAGG - Intronic
923080643 1:230650806-230650828 TCTAGGATTTTTATAGTTTCAGG + Intronic
923795457 1:237150354-237150376 TCAATGATATTGATAGATTGAGG - Intronic
924629381 1:245722606-245722628 ACTTAGATATTGATATCTTCTGG - Intergenic
1063017126 10:2089592-2089614 ATTAGGAAAATGATAGAATCTGG + Intergenic
1064857835 10:19791515-19791537 AGTAAGATATTCATAGGTTCTGG - Intergenic
1064868134 10:19905414-19905436 ACTGGGTTTTTGATAGACTCTGG + Intronic
1065273215 10:24058009-24058031 TCTAGGAAATTTATAGTTTCAGG + Intronic
1065644087 10:27816417-27816439 CCTAGGATATTGAACGATGCTGG - Intronic
1065700154 10:28417124-28417146 TCTAGGATTTTCATAGTTTCAGG + Intergenic
1068172656 10:53416140-53416162 TCTAGAATATTTATAGTTTCAGG + Intergenic
1068349328 10:55822817-55822839 ACAAAGAAATTGATTGATTCTGG - Intergenic
1068838647 10:61585300-61585322 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1069046162 10:63745804-63745826 TCTAGGATATTTATAGTTTGAGG - Intergenic
1069378894 10:67822073-67822095 ACTAGGTTAAGGATAGATTTGGG + Intronic
1069419609 10:68235260-68235282 ACTAGGTAAATGATAGATGCGGG + Intergenic
1071248202 10:83787842-83787864 CCTAGGATTTTTATAGTTTCAGG + Intergenic
1071290192 10:84183288-84183310 ACTAAGTAAGTGATAGATTCAGG + Intronic
1072056559 10:91763848-91763870 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1073827725 10:107344691-107344713 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1074930998 10:118126086-118126108 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1075884276 10:125884068-125884090 ACTATGACATTTATAGACTCTGG + Intronic
1077944501 11:6880529-6880551 ACTAGAATATAGATATCTTCGGG - Intergenic
1081053416 11:38375557-38375579 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1082955193 11:58863389-58863411 CCTAGGATATTGGTAGATGGGGG + Intronic
1083507792 11:63175710-63175732 TCTAGGATTTTGATAGTTTCAGG + Intronic
1083607082 11:63985519-63985541 ACCAGGATACTGACAGAGTCAGG + Intronic
1085967877 11:81550753-81550775 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1086824870 11:91484306-91484328 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1087652230 11:100881197-100881219 TCTAGAATTTTTATAGATTCAGG + Intronic
1087693002 11:101343745-101343767 CCTAGGATTTTTATAGGTTCAGG + Intergenic
1088414219 11:109571088-109571110 TCTAGAATTTTGATAGTTTCAGG - Intergenic
1093589777 12:20887836-20887858 CCTAGGATTTTTATAGTTTCAGG + Intronic
1094234949 12:28153048-28153070 TCTAGGATTTTTATAGTTTCAGG + Intronic
1097960027 12:65523189-65523211 ACTGGGATATTGATTTCTTCAGG + Intergenic
1098437064 12:70479199-70479221 ACTAGAAAATAGATAAATTCCGG - Intergenic
1098526418 12:71492077-71492099 AGTTGGATATTTATAGGTTCAGG + Intronic
1099265898 12:80447511-80447533 ACTAGTATTTTTATAGTTTCAGG + Intronic
1099381939 12:81965323-81965345 TCTAGGAGATTTATAGTTTCAGG + Intergenic
1100188525 12:92163847-92163869 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1101187690 12:102296780-102296802 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1105556916 13:21456101-21456123 TATAGGATATTCTTAGATTCTGG - Intronic
1105768231 13:23581625-23581647 ACTAGGAAATTAATATATTAAGG - Intronic
1106105692 13:26731505-26731527 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1106424940 13:29618564-29618586 TCTAGGATTTTTATAGCTTCAGG - Intergenic
1106692510 13:32133620-32133642 AATATGATATTGATAGAATGAGG + Intronic
1106736844 13:32596608-32596630 ACTAGAACATTCATATATTCAGG - Intronic
1109444863 13:62422269-62422291 ACCAGGATATTAATATATTGTGG + Intergenic
1109619699 13:64887529-64887551 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1109746747 13:66633492-66633514 AAAAGGATATTGATAGATTGAGG - Intronic
1110463568 13:75775338-75775360 TCTAGGATTTTTATAGTTTCAGG - Intronic
1110703148 13:78572973-78572995 GCTAGGAATTAGATAGATTCAGG + Intergenic
1111846146 13:93511301-93511323 ACTAGTATTTTTATAGTTTCAGG + Intronic
1111917720 13:94378724-94378746 TCTATGCTATTGATAGATTCTGG - Intronic
1114767650 14:25392488-25392510 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1115046147 14:28996934-28996956 TCTAGGATTTTTATAGATTTTGG - Intergenic
1115620317 14:35134402-35134424 ACTCTGATATTGCTAGCTTCAGG - Intronic
1115637267 14:35302127-35302149 ACTAGGACATAGATATATTTTGG + Intronic
1116173215 14:41429580-41429602 TCTAGGATTTTAATAGTTTCAGG - Intergenic
1116199604 14:41774608-41774630 ATCAGGAATTTGATAGATTCAGG + Intronic
1116930520 14:50686590-50686612 ACTTGGATATTGATATCTTCAGG + Intergenic
1117014699 14:51506739-51506761 ACTAGGTTATTGATATAAACAGG - Intronic
1117481572 14:56151008-56151030 ACTATGAAAATGAAAGATTCAGG + Intronic
1119929232 14:78528595-78528617 ATTGAGATTTTGATAGATTCAGG + Intronic
1120558682 14:85962435-85962457 GGTAGCATATTGACAGATTCTGG - Intergenic
1120748293 14:88173340-88173362 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1123453008 15:20385154-20385176 ACTAGCATGTTTACAGATTCTGG - Intergenic
1123721191 15:23063446-23063468 ACTGGGATATTGAGAGAGACTGG + Intergenic
1124478125 15:30053714-30053736 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1124875555 15:33589571-33589593 TCTAGGATTTTCATAGTTTCAGG + Intronic
1125075322 15:35608169-35608191 ACTAAGAGATTGATAAATACTGG - Intergenic
1125091106 15:35793850-35793872 ACTAGGATGTTGAGGGATTCAGG - Intergenic
1126150524 15:45519860-45519882 ACTAGAATATTGAGTCATTCAGG - Intronic
1131874908 15:96795074-96795096 GTTAGGATATTGTTAGACTCAGG - Intergenic
1139048194 16:63089069-63089091 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1141035920 16:80625510-80625532 CCTAGCATAGTCATAGATTCTGG + Intronic
1143412509 17:6719285-6719307 ACTAGGATTTTCTTAGATTTTGG + Intergenic
1143991708 17:10969397-10969419 TCTAGGATATTTATAGTTTGAGG - Intergenic
1144432380 17:15205805-15205827 GCTAGGATATTTATAGTTTTGGG - Intergenic
1144450688 17:15375668-15375690 AGTAAGATATGTATAGATTCAGG - Intergenic
1144909537 17:18670018-18670040 ACTAGAATAATGATATTTTCAGG - Intronic
1146427196 17:32752307-32752329 TCTAGGATTTTTATAGCTTCAGG - Intronic
1146891658 17:36510313-36510335 CCTAGGAGTTTGATAGATTGTGG - Intronic
1149377199 17:56056703-56056725 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1151400289 17:73851496-73851518 ACCAGAACACTGATAGATTCAGG - Intergenic
1152049470 17:77960590-77960612 GCAATGATATTCATAGATTCCGG + Intergenic
1155801651 18:30112637-30112659 ACTTGGATATTCACAGATTTTGG - Intergenic
1156340702 18:36207905-36207927 TCTAGGATTTTTATAGTTTCAGG + Intronic
1159172084 18:64783920-64783942 CCTAGGATTTTTATAGATTTTGG - Intergenic
1161881732 19:6959224-6959246 AATAGAATCTTGATAGATGCTGG - Intergenic
1164389163 19:27802868-27802890 CCTAAGATATTCACAGATTCTGG - Intergenic
1165548045 19:36558666-36558688 TCTAGGATTTTTATAGTTTCAGG - Intronic
926659624 2:15449748-15449770 ACAAGGTTATTCTTAGATTCAGG + Intronic
927360038 2:22222535-22222557 AATAGGATATTTACAGATTTAGG + Intergenic
929389184 2:41449237-41449259 TCTAGGATTTTTATAGATTTGGG - Intergenic
929722494 2:44384596-44384618 TCTAGAATTTTGATAGTTTCAGG + Intronic
930355396 2:50312231-50312253 ACCTGGATATGCATAGATTCAGG + Intronic
930628321 2:53723963-53723985 ACTAGGATTTTTATAGTTTGAGG - Intronic
932084132 2:68743035-68743057 ATAAGGATAATGATAGCTTCTGG + Intronic
933489944 2:82973251-82973273 ATTACGCTTTTGATAGATTCTGG + Intergenic
934110157 2:88734732-88734754 CCTAGGATATTGATAGCATATGG + Intronic
935939099 2:108220114-108220136 ACTAGGATATGGATATCTTCCGG + Intergenic
935982000 2:108636594-108636616 ACTGGGATATTGCTAGGTGCTGG - Intronic
938588095 2:132711656-132711678 AATAGGATATTTATGGATTATGG - Intronic
938665884 2:133536248-133536270 TCTAGGATTTTTATAGTTTCAGG + Intronic
939662920 2:144912742-144912764 TCTAGGATTTTTATAGTTTCAGG + Intergenic
940383255 2:153041276-153041298 ACTATAATGTTGATAGATTGAGG - Intergenic
942054653 2:172171261-172171283 ACTAAGATATTGAAAAACTCAGG + Intergenic
944454479 2:199878888-199878910 ACCATAATATTGATAGAGTCAGG - Intergenic
945626444 2:212212948-212212970 TCTAGGATTTTTATAGATTTTGG - Intronic
947944562 2:234090538-234090560 AGTAGCATATTCACAGATTCTGG + Intergenic
1169619935 20:7494390-7494412 TCTAGGATTTTGATAGTTTGAGG - Intergenic
1170953887 20:20961102-20961124 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1177617988 21:23549676-23549698 TCTAGGATAGTGATACCTTCTGG - Intergenic
1177783538 21:25644659-25644681 AGTAAGATATTTATAGGTTCTGG + Intronic
1177789749 21:25710000-25710022 AGTGGGATGTTGATAGAGTCTGG - Intronic
1178992044 21:37365208-37365230 ACTAGGACATTGATATACTAAGG - Intergenic
1183310993 22:37109453-37109475 ACTAGGTCATTTATAGATCCCGG + Intronic
1185170207 22:49289068-49289090 ACTGGGAGATGGACAGATTCCGG - Intergenic
949321401 3:2815117-2815139 ACTAGAATGTTTATAGTTTCAGG - Intronic
949420690 3:3862762-3862784 ACTAGAATATTCATACATTGTGG + Intronic
949425046 3:3907594-3907616 ACTAGGATATGGGTAGAATTGGG + Intronic
949746528 3:7300325-7300347 ACTAGGAGATGGATGGATTCAGG - Intronic
952581466 3:34838352-34838374 CCTAGGAAACTAATAGATTCTGG - Intergenic
953583974 3:44183099-44183121 ACAAAGATGTAGATAGATTCAGG + Intergenic
953755356 3:45641358-45641380 TCTTGGTTATTGATAGAGTCTGG + Intronic
956886137 3:73562030-73562052 ACTAGGAAATTCATAAATTCTGG + Intronic
957896838 3:86431910-86431932 TCTAGGATATTTATAGTTTTAGG - Intergenic
957972081 3:87395226-87395248 TCTAGAATTTTGATAGTTTCAGG - Intergenic
958469229 3:94497213-94497235 ACTGGGATTTTCAAAGATTCTGG + Intergenic
959974352 3:112441587-112441609 TCTAGGATTTTTATAGATTAAGG - Intergenic
960333107 3:116386873-116386895 ACTAGAATTTTGATAGATGGAGG + Intronic
960894985 3:122494250-122494272 TCTAGGATTTTTATAGTTTCAGG + Intronic
963089423 3:141468752-141468774 TCTAGGATTTTAATAGCTTCAGG + Intergenic
965378262 3:167954395-167954417 TCTAGAATATTTATAGTTTCAGG + Intergenic
966990932 3:185229360-185229382 ACTAGGATTTAGAAAAATTCTGG - Intronic
968114650 3:196080553-196080575 ACTAGCATTGTGATCGATTCAGG + Intronic
970153256 4:13113500-13113522 TCTAGGATTTTTATAGTTTCAGG - Intergenic
970346317 4:15155801-15155823 ACTAGGATTTCTATAGTTTCAGG + Intergenic
970961053 4:21871632-21871654 GATAAGATATTGATGGATTCTGG - Intronic
971450626 4:26797924-26797946 TCTAGGATTTTTATAGTTTCAGG - Intergenic
972236019 4:37135163-37135185 ACTAGGATATTGCTATGATCTGG + Intergenic
973059771 4:45707595-45707617 TCTAGGATTTTAATAGTTTCAGG + Intergenic
973597632 4:52508689-52508711 TCTAGGATTTTTATAGTTTCAGG - Intergenic
974496508 4:62635215-62635237 CCTAGGATTTTTATAGATTTTGG - Intergenic
974507906 4:62800848-62800870 TCTAGGATTTTTATAGTTTCAGG + Intergenic
974826406 4:67136395-67136417 TCTAGGATTTTTATAGTTTCAGG - Intergenic
975667828 4:76750959-76750981 AAAAGGATATTGATAATTTCAGG + Intronic
977562836 4:98549999-98550021 TCTAGGATTTTTATAGTTTCAGG + Intronic
978187873 4:105879126-105879148 ACTATGATATTAATAGAAGCTGG - Intronic
978554704 4:109967154-109967176 TCTAGGATTTTTATAGTTTCAGG + Intronic
979553672 4:122020447-122020469 TCTAGGATTTTTATAGTTTCAGG - Intergenic
980558040 4:134434530-134434552 TCTAGGATTTTTATAGTTTCAGG - Intergenic
980767519 4:137327004-137327026 TCTAGGATTTTTATAGTTTCAGG + Intergenic
981593196 4:146388451-146388473 TCTAGGATTTTTATAGTTTCAGG - Intronic
982562876 4:156952179-156952201 AAGAGGATATTGGTAGAATCAGG - Intronic
983527404 4:168773257-168773279 ACCAGGATTTTGATAGATAAGGG - Intronic
983683419 4:170379290-170379312 TCTAGGATTTTTATAGTTTCAGG - Intergenic
983815405 4:172120567-172120589 AGTAACATATTGATAGGTTCTGG + Intronic
983951000 4:173641350-173641372 TCTAGGATTTTTATAGTTTCAGG - Intergenic
984320354 4:178187994-178188016 ACTTCTATATTGATAGATTTTGG + Intergenic
984831397 4:183978210-183978232 TCTAGGATTTTAATAGTTTCAGG + Intronic
986521635 5:8625386-8625408 TCTAGGATTTTTATAGTTTCAGG + Intergenic
987414020 5:17644018-17644040 TCTAGAATTTTTATAGATTCAGG + Intergenic
988651241 5:33153991-33154013 TCTAGGATAGTGATACACTCAGG + Intergenic
990401858 5:55446035-55446057 ACTAGAATATTGATTGATGGGGG - Intronic
991500863 5:67275574-67275596 ACTAGGAAATAGATAAATTGTGG - Intergenic
991605657 5:68397955-68397977 CCTACCATATTCATAGATTCTGG - Intergenic
991615050 5:68487726-68487748 TCTAGGATATTTACAGTTTCAGG + Intergenic
994047509 5:95326542-95326564 TCTAGGATTTTTATAGTTTCAGG - Intergenic
994659409 5:102635576-102635598 TCTAGGATTTTTATAGTTTCCGG - Intergenic
995008527 5:107230806-107230828 AGTAGGATTTTGAAAGATTTTGG + Intergenic
995495076 5:112733270-112733292 CCTAACATATTCATAGATTCTGG - Intronic
995694281 5:114862408-114862430 TCTAGAATTTTTATAGATTCAGG + Intergenic
996323519 5:122246730-122246752 TCTAAGATTTTGATAGCTTCAGG + Intergenic
996325822 5:122272095-122272117 TCTAGAATATTTATAGTTTCAGG - Intergenic
999066452 5:148691959-148691981 TCTAGGATATTTATTGTTTCGGG - Intergenic
999837146 5:155386479-155386501 AATAGGATATTCAAAGGTTCAGG - Intergenic
1004115790 6:12766444-12766466 ACTATGAAATTTCTAGATTCCGG - Intronic
1004832598 6:19493767-19493789 ACTAGAACATTTATAGATTTTGG + Intergenic
1005089294 6:22039708-22039730 CCTAGGAGATTTATAGATTTAGG + Intergenic
1006422023 6:33940791-33940813 AATAGGATATTGATATTTCCTGG - Intergenic
1009495439 6:64340835-64340857 TTTAAGTTATTGATAGATTCTGG - Intronic
1009553361 6:65129199-65129221 TCTAGGATATTTATAGTTTGAGG - Intronic
1009710062 6:67306870-67306892 TCTAGAATTTTCATAGATTCAGG + Intergenic
1010520434 6:76825921-76825943 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1011140979 6:84156252-84156274 TCTAGGATTTTTATAGTTTCAGG - Intronic
1012068866 6:94585955-94585977 TCTAGGATTTTCATAGTTTCAGG - Intergenic
1013285842 6:108680656-108680678 ACTAGAATATTGATATTTTCAGG + Exonic
1013433978 6:110083045-110083067 AATAGAAAATTGATAAATTCAGG - Intergenic
1014296488 6:119624960-119624982 ACGAGGACTTTGATAGATACAGG - Intergenic
1015233845 6:130947896-130947918 ATTAGGATATTGATGAATTATGG + Intronic
1016095431 6:140031499-140031521 ACTATGATATTGAGAAATGCAGG + Intergenic
1017796098 6:157845902-157845924 ACTAGGATACTGATTTATTAAGG - Intronic
1020495002 7:8839533-8839555 ACTAGGATTTTTATAGTTTCAGG + Intergenic
1020988332 7:15164272-15164294 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1021458534 7:20858607-20858629 AGTAGAATATTGATATATTTTGG - Intergenic
1022734906 7:33066472-33066494 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1024340743 7:48256408-48256430 TCCAGGATATTGATAGTTTTAGG + Intronic
1025063450 7:55831504-55831526 TCTAGGATTTTTATAGCTTCTGG - Intronic
1025618515 7:63145768-63145790 TCTAGGATTTTTATAGCTTCTGG - Intergenic
1027751879 7:82159448-82159470 ACTAGCTTATTCAGAGATTCAGG + Intronic
1028059006 7:86286114-86286136 TCTAGAATTTTTATAGATTCAGG + Intergenic
1028417302 7:90594927-90594949 TGTAGGATCTTGATAGATTGCGG - Intronic
1028672553 7:93419963-93419985 AGTAGCATATTGATACATTCAGG - Intergenic
1029000133 7:97144425-97144447 TCTAGGATTTTTATAGTTTCAGG + Intronic
1029012030 7:97272363-97272385 ACTAGGAGAAAGTTAGATTCGGG + Intergenic
1030142317 7:106318017-106318039 CCAAGGATATTTCTAGATTCTGG - Intergenic
1030923711 7:115424543-115424565 ACTAGGAAATTCTTAGATTTGGG + Intergenic
1031268694 7:119616535-119616557 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1032290451 7:130585346-130585368 TCTAGGATTTTTATAGTTTCAGG - Intronic
1032330717 7:130976475-130976497 CCTAGGAGTTTTATAGATTCAGG - Intergenic
1033391686 7:140934828-140934850 TATAGGATATTGAGAAATTCAGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1037194429 8:16170600-16170622 ATTAGAAAATTGATAGACTCAGG - Intronic
1038463643 8:27739681-27739703 CCTAGGATTTTGGTAGCTTCGGG + Intronic
1043871052 8:85433407-85433429 TCTAGGATTTTTATAGTTTCAGG + Intronic
1045946951 8:107807227-107807249 AGTAGGATATTGATGAAATCGGG - Intergenic
1047711618 8:127558412-127558434 AGTAACATATTCATAGATTCTGG + Intergenic
1049809610 8:144559407-144559429 ACTAGTAGATGGATGGATTCTGG + Intronic
1051412789 9:16808439-16808461 ACTAGGATATTGATAGATTCAGG - Intronic
1051429496 9:16967356-16967378 TCTAGGAGTTTCATAGATTCAGG + Intergenic
1051784234 9:20724268-20724290 AATAGGAAATTGATAAATTATGG - Intronic
1052540516 9:29805377-29805399 TCTTGAATATTGATAGATTTGGG - Intergenic
1053038912 9:34852278-34852300 AGTAGGCTATTGGTAAATTCTGG + Intergenic
1053116637 9:35510167-35510189 AGTATGTTATTGATAGATTCCGG + Intronic
1053554342 9:39119715-39119737 CCAAGTATAATGATAGATTCTGG + Intronic
1053818437 9:41939865-41939887 CCAAGTATAATGATAGATTCTGG + Intronic
1054108699 9:61083513-61083535 CCAAGTATAATGATAGATTCTGG + Intergenic
1054612158 9:67247612-67247634 CCAAGTATAATGATAGATTCTGG - Intergenic
1055365108 9:75535497-75535519 AATGGGATAATGATATATTCAGG + Intergenic
1055544228 9:77350384-77350406 ACTAGGATATAGAAATATTGAGG - Intronic
1058116595 9:101091690-101091712 CCTAGTATATTCATAGATTCTGG + Intronic
1058236093 9:102491837-102491859 ACTAGGATTTTTATAGTTTGAGG - Intergenic
1059075025 9:111183784-111183806 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1059262257 9:112989239-112989261 TCTAGGATATTTATAGTTTTGGG + Intergenic
1059589372 9:115641492-115641514 TTTAGGATTTTTATAGATTCAGG + Intergenic
1060323257 9:122585948-122585970 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1060840219 9:126787059-126787081 ACTAGGATAAAGATAGATAATGG + Intergenic
1188588493 X:31805082-31805104 ATTAGTATATTGATAAATTAAGG + Intronic
1188638679 X:32469859-32469881 GATAGGATATTGATTGATTGAGG - Intronic
1189733546 X:44046847-44046869 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1191018615 X:55836961-55836983 ACTAAGTTCTTTATAGATTCTGG + Intergenic
1192184245 X:68935892-68935914 ACTGGGATTTAGATAAATTCAGG - Intergenic
1193521131 X:82530085-82530107 ACTAGGATGTTGGTAGATCTAGG - Intergenic
1193643292 X:84038264-84038286 TCTAGTATATTTATAGTTTCAGG + Intergenic
1193737951 X:85183187-85183209 ACTAGTATTTTTATAGTTTCGGG + Intergenic
1193892771 X:87071115-87071137 ACTAGGATGTTGATATCTTTGGG + Intergenic
1194245376 X:91504831-91504853 TCTAGGATTTTGATAGTTTGAGG - Intergenic
1194251636 X:91583026-91583048 TCTAGTATTTTGATAGTTTCAGG + Intergenic
1195663801 X:107409517-107409539 TCTAGGATTTTTATAGTTTCAGG + Intergenic
1196006865 X:110845868-110845890 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1196475812 X:116084141-116084163 TCTAGGATTTTCATAGTTTCAGG - Intergenic
1196700639 X:118664138-118664160 ACCAGGGTAGTGAAAGATTCAGG + Intronic
1197007947 X:121525743-121525765 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1199206305 X:145152769-145152791 TCTAGGATTTTTATAGTTTCAGG - Intergenic
1200564345 Y:4746137-4746159 TCTAGGATTTTGATAGTTTGAGG - Intergenic
1200570571 Y:4824258-4824280 TCTAGTATTTTGATAGTTTCAGG + Intergenic
1202036003 Y:20636353-20636375 TCTAGGATTTTTATAGTTTCAGG + Intergenic