ID: 1051413596

View in Genome Browser
Species Human (GRCh38)
Location 9:16815716-16815738
Sequence AGATTTGTACTACTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051413593_1051413596 4 Left 1051413593 9:16815689-16815711 CCTGCTATATCTGTGCTTCCCAC 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data
1051413588_1051413596 29 Left 1051413588 9:16815664-16815686 CCCCCTTTCTTTTTAGCCTAAAC 0: 1
1: 0
2: 2
3: 28
4: 248
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data
1051413589_1051413596 28 Left 1051413589 9:16815665-16815687 CCCCTTTCTTTTTAGCCTAAACT 0: 1
1: 0
2: 2
3: 24
4: 330
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data
1051413591_1051413596 26 Left 1051413591 9:16815667-16815689 CCTTTCTTTTTAGCCTAAACTTC 0: 1
1: 0
2: 1
3: 32
4: 292
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data
1051413592_1051413596 13 Left 1051413592 9:16815680-16815702 CCTAAACTTCCTGCTATATCTGT 0: 1
1: 0
2: 0
3: 14
4: 213
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data
1051413590_1051413596 27 Left 1051413590 9:16815666-16815688 CCCTTTCTTTTTAGCCTAAACTT 0: 1
1: 0
2: 3
3: 46
4: 474
Right 1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051413596 Original CRISPR AGATTTGTACTACTATTTAT TGG Intronic
No off target data available for this crispr