ID: 1051416540

View in Genome Browser
Species Human (GRCh38)
Location 9:16846736-16846758
Sequence TGGATTGGTCTAAAATAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051416540_1051416543 7 Left 1051416540 9:16846736-16846758 CCAAATTATTTTAGACCAATCCA 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1051416543 9:16846766-16846788 TAAGTGACCAAAGCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051416540 Original CRISPR TGGATTGGTCTAAAATAATT TGG (reversed) Intronic
902132759 1:14277788-14277810 GGAATTGCTCCAAAATAATTTGG - Intergenic
903850676 1:26304061-26304083 TGGATTTGTCCTAAAAAATTTGG - Intronic
909862492 1:80625872-80625894 TGGACTGGTTTAAAAAAATGTGG - Intergenic
916395462 1:164382019-164382041 AGGATTGTTCTAAAATATTTAGG - Intergenic
919614136 1:199784221-199784243 TGGAATGATGTAAAATATTTGGG + Intergenic
920122750 1:203671055-203671077 TGGATTGGTATACACTTATTAGG - Intronic
920491750 1:206421212-206421234 TGGATTGGTCCAATCTGATTCGG + Intronic
924561347 1:245158179-245158201 AAGAAAGGTCTAAAATAATTTGG - Intronic
1063017872 10:2096393-2096415 TGGAATGGTTTAAAAGGATTGGG - Intergenic
1064945728 10:20786599-20786621 TGAATTGCTCTAAAATTCTTTGG - Intronic
1067775270 10:49160135-49160157 TGAATAGGTATAAAATCATTAGG + Intronic
1067791039 10:49288070-49288092 TGTTTTGTCCTAAAATAATTTGG - Intergenic
1068215989 10:53982849-53982871 TATAATGGACTAAAATAATTAGG + Intronic
1068387097 10:56344635-56344657 TGCTCTTGTCTAAAATAATTTGG - Intergenic
1068508895 10:57938571-57938593 TGAATTGCTTTAAAATAACTTGG + Intergenic
1069126174 10:64637210-64637232 TGAATTGAACTAAAATATTTGGG + Intergenic
1069714189 10:70510060-70510082 TGGATTTGCCTAAAATATTGGGG + Intronic
1071041506 10:81314548-81314570 GGGATTGTTATAAACTAATTTGG + Intergenic
1071394019 10:85203963-85203985 TGGATTTGGCTCAAACAATTGGG - Intergenic
1074966208 10:118492920-118492942 TGGAATGTTTTAAAATAATGAGG - Intergenic
1077854723 11:6112131-6112153 TGGATTTTACTAAAATAATTTGG + Intergenic
1078280013 11:9891983-9892005 TGGATTAATTAAAAATAATTAGG + Intronic
1078770499 11:14346535-14346557 TGGCTGGGTATAAAATTATTGGG - Intronic
1080184185 11:29459961-29459983 TGAATTGGCCTTAGATAATTTGG + Intergenic
1082687962 11:56262567-56262589 TGGATTTGTATCAAAAAATTTGG + Intergenic
1084018303 11:66400437-66400459 AGGCTTTGTCTAAAATCATTGGG + Intergenic
1084796436 11:71508331-71508353 TGGATAGCTCTATAATTATTAGG + Intronic
1085070690 11:73541909-73541931 TGGTTTGGTTTTAAATAACTGGG - Intronic
1090961792 11:131563664-131563686 TGGATTGATTTCAAATAACTAGG + Intronic
1092498647 12:9023921-9023943 TAAATGGTTCTAAAATAATTGGG - Intergenic
1092935296 12:13356655-13356677 TAAATTGGTTTAATATAATTTGG + Intergenic
1094651429 12:32380704-32380726 TGGATTCTAATAAAATAATTTGG + Intronic
1095715261 12:45338567-45338589 TGCTTTAGTCTAAAATATTTAGG - Intronic
1096646546 12:53040854-53040876 TGCATTGGACCAAAATAAATGGG + Exonic
1097290147 12:57907561-57907583 TGGTTTGGGCTAAAAGAATCAGG - Intergenic
1097384413 12:58932471-58932493 TGGATTGTTTTAGAATATTTAGG - Intergenic
1097855729 12:64459786-64459808 TTGATTAGTTTAAAATTATTAGG + Intronic
1099242929 12:80159957-80159979 TGGCTTTGTCAAAAATCATTTGG - Intergenic
1099361063 12:81702452-81702474 TGAAGTGGATTAAAATAATTTGG - Intronic
1099536440 12:83851371-83851393 TGGCTTTGTCTAAAATAAGTTGG + Intergenic
1100046724 12:90391280-90391302 AGCAGTGGTTTAAAATAATTAGG - Intergenic
1102538836 12:113603302-113603324 TTGATTATTATAAAATAATTAGG - Intergenic
1105707996 13:22980693-22980715 TGGATTGGCATGAAATAATGGGG - Intergenic
1107669047 13:42724191-42724213 TGTATTGGCCTAAGAGAATTGGG + Intergenic
1108603470 13:52014914-52014936 ATAATTGGTCTAAAATAATTTGG - Intronic
1109772213 13:66991219-66991241 TGGATTGATCTTACAAAATTGGG - Intronic
1110961603 13:81633288-81633310 GGGATTGATGTAGAATAATTGGG + Intergenic
1111208539 13:85045671-85045693 TGGATTTGTTTTAAATAATCAGG - Intergenic
1112101407 13:96193569-96193591 TGGATATGTCTTAAATATTTAGG + Intronic
1113352049 13:109538908-109538930 TGTCTTGGTCTAAAATATCTGGG + Intergenic
1117034931 14:51718424-51718446 TCCATTGTTCTAAAATAATTAGG - Intronic
1119498113 14:75098385-75098407 AGGATTGGTCTAAGATAACTGGG + Intronic
1120433310 14:84447100-84447122 TAGACTGTTTTAAAATAATTTGG + Intergenic
1120600747 14:86504297-86504319 TGAATTTTTCTAAAATTATTAGG + Intergenic
1120796163 14:88635522-88635544 TGGATAGCTTTAAAATATTTAGG - Intronic
1122441097 14:101732358-101732380 TGGATTTGTCTCAAAAACTTGGG + Exonic
1124182109 15:27486003-27486025 TCCAGTTGTCTAAAATAATTTGG + Intronic
1126269457 15:46797544-46797566 TGACTTTGTCTAAAATAATTTGG - Intergenic
1127074986 15:55316892-55316914 TAGATTGGTTTAATATATTTTGG - Intronic
1128051560 15:64669372-64669394 TGGAATGATCCAAAATATTTGGG + Intronic
1133344689 16:5062027-5062049 TGAAGTGGATTAAAATAATTTGG + Intronic
1134419555 16:14072443-14072465 TGTATTGGTTAAAAAAAATTAGG + Intronic
1135897877 16:26425411-26425433 TGGTTTCGTCTAATATATTTTGG - Intergenic
1139108480 16:63858847-63858869 TGAATAGATCTAGAATAATTGGG - Intergenic
1141289534 16:82704825-82704847 TGGATTTGTATGAAATAAATAGG + Intronic
1141396924 16:83713366-83713388 TGGCTTTGTCAAAAATAAGTCGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1153093566 18:1375117-1375139 GGGATTGGTCTGGAATAAGTGGG + Intergenic
1153341970 18:3984694-3984716 TGGACTGGCCTAACATAAATAGG - Intronic
1154530321 18:15337755-15337777 TGGATAAGGCTAAAATAAATTGG + Intergenic
1156413577 18:36861970-36861992 TGGATTAGAATAAAATAAATGGG - Intronic
1158638582 18:59182580-59182602 TTCATTGGTCTAAAAAAGTTTGG - Intergenic
1158775803 18:60577851-60577873 TGAATGGGTCTAGACTAATTTGG - Intergenic
1159287157 18:66369313-66369335 TGGGTTGGTATAAAATAAACAGG + Intergenic
1159562888 18:70014715-70014737 TGGATGGGTCAAAAATAAGTTGG - Intronic
1162120928 19:8467678-8467700 TGGATTAGTCTAAGTTAAATAGG + Intronic
1165158103 19:33800088-33800110 TGGTTTGTTCTGAAATATTTTGG + Intronic
926667748 2:15543384-15543406 TGGACTGGTGGAAAATAATGGGG - Intronic
928929890 2:36613495-36613517 TTGATTTTTCAAAAATAATTTGG - Intronic
929678265 2:43960932-43960954 TGCATTAATCTAAAATATTTTGG + Intronic
930374165 2:50542865-50542887 TAAATTGGTTTAAACTAATTCGG - Intronic
930576664 2:53159064-53159086 TGGATGTGTCTAAGTTAATTCGG - Intergenic
931347048 2:61456309-61456331 TTGATTGGTTTAAACTAATCAGG - Intronic
931613471 2:64129441-64129463 TGTATTTGTTTAAACTAATTGGG + Intronic
933245752 2:79972978-79973000 ATGATTGATCTAAAATTATTTGG + Intronic
935481956 2:103601338-103601360 TGATTTGGTCAAAAATAATGTGG - Intergenic
938529425 2:132169217-132169239 TGGATGAGGCTAAAATAAATTGG + Intronic
939622884 2:144441692-144441714 TGGCTTAGTCTAAAACACTTAGG - Intronic
940200842 2:151148661-151148683 TGTATTTTTCTAGAATAATTGGG - Intergenic
940658056 2:156512798-156512820 TGGATAGCTCTAAAAACATTAGG - Intronic
941517727 2:166500396-166500418 TTGACTTGTCTTAAATAATTGGG - Intergenic
943377353 2:187095016-187095038 TTGCTTGGTTAAAAATAATTCGG + Intergenic
943487841 2:188509780-188509802 TGGTTTGTTCTCAAATAATGAGG + Intronic
945931473 2:215859752-215859774 TGGATAGGTCAAAAATAACTAGG + Intergenic
946412912 2:219524031-219524053 TAGATTGGTCTCAAATTCTTGGG + Intronic
947239138 2:227975478-227975500 TTGCTAGGTTTAAAATAATTGGG + Intergenic
947428051 2:230001666-230001688 TGGACTGGACACAAATAATTTGG - Intronic
1170253677 20:14315754-14315776 TGTATTGTTTTAAAACAATTAGG + Intronic
1171412821 20:24958161-24958183 TGCAATTGTCAAAAATAATTAGG - Intronic
1171511567 20:25689680-25689702 TGGATTTGTTTGAAATACTTTGG + Intronic
1176738033 21:10570891-10570913 TGGTTTAGTCTAAAATGACTTGG + Intronic
1176767087 21:13030702-13030724 TGGATGAGGCTAAAATAAATTGG - Intergenic
1177424976 21:20911001-20911023 TGGCTTGCTTTAAAATATTTTGG + Intergenic
1177720738 21:24903574-24903596 AGGATTCTTCTAAAATATTTTGG - Intergenic
1177910167 21:27020900-27020922 TGGATAAGTCTAAAATTGTTAGG + Intergenic
949250731 3:1980378-1980400 AGCCTTGGTCTAAAATGATTTGG - Intergenic
952625385 3:35396560-35396582 TTGTTTGGTCTAAAATTATTTGG + Intergenic
954737255 3:52716569-52716591 TGGATTGGTCTCAGTTAATAGGG - Intronic
956330303 3:68099763-68099785 TGGATTGGACAAAGAAAATTTGG + Intronic
957336296 3:78833506-78833528 TTAATTGTACTAAAATAATTAGG + Intronic
957633688 3:82752918-82752940 AGTATTTTTCTAAAATAATTCGG + Intergenic
957643746 3:82891219-82891241 TGGTTTTGATTAAAATAATTGGG - Intergenic
958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG + Intronic
961192138 3:124970869-124970891 TACATTGGTCTAAAATCATTGGG - Intronic
962511828 3:136108843-136108865 TGGCTTGGTCTAAAATTCTTGGG - Intronic
963860158 3:150301272-150301294 TTGATTGGACTAAAATAAAAAGG - Intergenic
965692918 3:171376890-171376912 AGGACTGGTCCAAAACAATTAGG + Intronic
967574540 3:191075272-191075294 TGGTTTGTTTTACAATAATTTGG - Intergenic
971186026 4:24376932-24376954 TGGATAAGTCTAAAATAAAATGG + Intergenic
974327074 4:60427134-60427156 TGGATTGTTCTTAAAGAAATGGG + Intergenic
974900606 4:67992509-67992531 TGGACTGGTCTAAAGTCATGAGG + Intergenic
974994557 4:69138636-69138658 TGGATTGATCAATAATAATGAGG + Intronic
976299991 4:83508110-83508132 TGGATGGGTCTTGAAAAATTAGG + Intronic
976437816 4:85038964-85038986 GAGATTAGTATAAAATAATTTGG - Intergenic
977660869 4:99584158-99584180 TGAAATGGTCTAAATAAATTTGG + Intronic
978033054 4:103959423-103959445 TGGATTGGATTAAAAAAATGTGG + Intergenic
978226472 4:106340664-106340686 TGGATTGGATTAAAAAAATGTGG - Intronic
978332034 4:107623985-107624007 TGGATTGGTTATAAAAAATTTGG - Intronic
979136759 4:117119452-117119474 ATGAATGGTATAAAATAATTAGG + Intergenic
980842658 4:138284362-138284384 TTGATTTTTCAAAAATAATTTGG - Intergenic
983522491 4:168724633-168724655 TAGATTTTTCTAAAATAAGTTGG + Intronic
984305521 4:177984484-177984506 TAGATTGGTTTAAAATTATCTGG - Intronic
985342520 4:188970460-188970482 TGGTTTGGGCAAAAATAACTCGG - Intergenic
985664890 5:1176955-1176977 TGTATTGGGCTAAAAGAATTTGG - Intergenic
986698739 5:10382863-10382885 TGTAATGGTCATAAATAATTGGG + Intronic
986739667 5:10695039-10695061 TGGCTTGGTCTTAATTTATTTGG + Intronic
986951562 5:13092677-13092699 TGGCTTTGTCAAAAATAAGTCGG - Intergenic
987624037 5:20374595-20374617 TGAATTGGTCTAAAATATGCCGG - Intronic
988683554 5:33505752-33505774 AGTATTTTTCTAAAATAATTTGG - Intergenic
988765836 5:34375243-34375265 TGGATTCATCTAAAGTAATAAGG + Intergenic
988779947 5:34511461-34511483 GGGATTTGTGTAAAATCATTCGG - Intergenic
991556459 5:67900428-67900450 AGGTTTGGTCTACAATTATTCGG + Intergenic
991679373 5:69123760-69123782 TGGGATGTTCTAAAATTATTTGG + Intronic
992610875 5:78507455-78507477 TGGATTAGTCCAACATATTTTGG - Intronic
994844746 5:104974306-104974328 TGGATATGGCTAAAATAAGTTGG - Intergenic
995229882 5:109747698-109747720 TTGCTTGTTCTAAAACAATTTGG - Intronic
995312087 5:110725215-110725237 TGGATTAGACAAAAATAAGTAGG + Intronic
997025180 5:130051979-130052001 TGGAATGTACTAAAATGATTAGG + Intronic
998782914 5:145678151-145678173 TGGGTTGTTCTGAACTAATTAGG + Intronic
999539561 5:152556743-152556765 TGGAATGGTTTAAAATTACTGGG + Intergenic
1000879118 5:166676965-166676987 TGGTTTGTTCTAAATTTATTTGG - Intergenic
1001900890 5:175428676-175428698 TGGATTGGATTAAAAAAATGTGG - Intergenic
1002702741 5:181137496-181137518 TTAAGTGCTCTAAAATAATTTGG - Intergenic
1003163688 6:3657725-3657747 TGGATTTGTTTAATAAAATTAGG + Intergenic
1004814184 6:19294569-19294591 TGGACTGGCTTAAAATACTTTGG + Intergenic
1005508156 6:26488333-26488355 GGTATTTCTCTAAAATAATTTGG - Intergenic
1007295834 6:40819883-40819905 TGGAGAGGTCTAAGATGATTGGG + Intergenic
1008666109 6:53718018-53718040 TTGCTAGGTCGAAAATAATTTGG - Intergenic
1011362820 6:86546666-86546688 TGGATTTTTCTAGAATAATTTGG - Intergenic
1011797875 6:90977464-90977486 AGTATTTGTCTAACATAATTTGG - Intergenic
1012507513 6:99964851-99964873 TGGATGGATCTAAAATCATAAGG + Intronic
1012810827 6:103955777-103955799 TGCATTGGTCTAGAAAATTTAGG - Intergenic
1014094958 6:117449762-117449784 TGGACTGGTCTGAAATTCTTGGG - Intronic
1014125020 6:117767341-117767363 TGCATTTGTCAAAAATAAGTGGG - Intergenic
1014843425 6:126246292-126246314 TGCATTTGTGAAAAATAATTGGG + Intergenic
1015072644 6:129114209-129114231 TGAACAGGTATAAAATAATTAGG + Intronic
1016454765 6:144218815-144218837 TGAATTGGTAGAAAATATTTTGG + Intergenic
1017333486 6:153226930-153226952 TTTATTAGACTAAAATAATTTGG - Intergenic
1018260351 6:161964256-161964278 TACATTGATTTAAAATAATTAGG - Intronic
1020916708 7:14203286-14203308 TGGATTAGTCAATAATAAATTGG + Intronic
1022907081 7:34867801-34867823 AGGATAAGTCTAAAATAGTTTGG + Intronic
1024612089 7:51075477-51075499 TGAAATGTACTAAAATAATTAGG + Intronic
1025074705 7:55932929-55932951 TGAATTGGTTAAAAATACTTTGG + Intronic
1026077273 7:67183715-67183737 TGGTTTGCTTTAAAATAATCTGG - Intronic
1026699596 7:72628386-72628408 TGGTTTGCTTTAAAATAATCTGG + Intronic
1029002191 7:97166116-97166138 TGGATGGGTATAGAATATTTGGG + Intronic
1030686347 7:112490969-112490991 TGGATTGATCAAAAACATTTGGG + Exonic
1030946972 7:115735461-115735483 TTGATTGGTCTGACATAATCTGG - Intergenic
1031582789 7:123497982-123498004 TAGGTTCCTCTAAAATAATTAGG + Intronic
1033265544 7:139883400-139883422 TGAACTGGTATAAAATAAATGGG - Intronic
1034096526 7:148413559-148413581 AGGATTGGTCTAATATCATTAGG + Intronic
1038522527 8:28245439-28245461 TGTATTAGGCTAAAAGAATTTGG - Intergenic
1041191202 8:55356674-55356696 GGGTTTGCTTTAAAATAATTTGG + Intronic
1043319119 8:78959877-78959899 TGGAGTTGCATAAAATAATTTGG + Intergenic
1047235262 8:123035883-123035905 AGGATTTGTCTGAAATAATAAGG + Intronic
1047274043 8:123391835-123391857 GGGATTGGATTAAAATAAATCGG - Intronic
1047624224 8:126639547-126639569 TGGAATGGTCTACAATGACTAGG + Intergenic
1048647380 8:136437500-136437522 TGGATGAGGCTAAAATAAATTGG + Intergenic
1051416540 9:16846736-16846758 TGGATTGGTCTAAAATAATTTGG - Intronic
1052228634 9:26120241-26120263 TGTATTGACCTATAATAATTAGG + Intergenic
1052669432 9:31536951-31536973 TGGGTGGGTCAAAAATATTTTGG - Intergenic
1055736023 9:79331583-79331605 TGTACTGGTCTAAAATGTTTGGG - Intergenic
1055872800 9:80903946-80903968 TGGATTGGTTTAGTATCATTTGG - Intergenic
1056068550 9:82962010-82962032 TGAATTGGCCGAAAATCATTTGG + Intergenic
1058336105 9:103831311-103831333 TGCAGTAGTCTAAAATAAGTTGG + Intergenic
1058690407 9:107515834-107515856 TGGTTTGGTGTAAAAATATTAGG - Intergenic
1060712104 9:125877333-125877355 TAGATTTGTCTAAAACAAGTGGG - Intronic
1203349272 Un_KI270442v1:62259-62281 TGGAATGGACTCAAATAAATTGG + Intergenic
1187317252 X:18207229-18207251 TGGAATGAGCTAAAATATTTTGG - Intronic
1188268687 X:28111534-28111556 TTGATTGGCCTAAACTAATCAGG + Intergenic
1189433040 X:40966403-40966425 TGGACTAGTCTCAAATAATCAGG - Intergenic
1189456662 X:41196716-41196738 TTGATTGGCTTAAAAGAATTAGG + Exonic
1190196506 X:48323873-48323895 AGGATTGGTCTAAAGGAATGGGG - Intergenic
1193186764 X:78522533-78522555 TGAATGGGTAAAAAATAATTAGG + Intergenic
1196079766 X:111619020-111619042 TGCATTGGACCAAAATAAATGGG - Intergenic
1196201317 X:112888902-112888924 AGGATTGTTCTAAAATTATTTGG + Intergenic
1197320425 X:125022696-125022718 TGCCTTGTTCTAAATTAATTAGG - Intergenic
1198846046 X:140912087-140912109 TGCATTGGTTGAAAATAATGCGG + Intergenic
1199411345 X:147527602-147527624 AAGATTGGTCTAAAAGAAGTAGG + Intergenic
1199440241 X:147859490-147859512 TGGATTAGAGAAAAATAATTTGG + Intergenic
1201332796 Y:12845534-12845556 TGGAATCATCTAAAATCATTTGG + Intronic
1202033567 Y:20606082-20606104 TGGATTGGGTTAAGAAAATTTGG + Intergenic