ID: 1051416850

View in Genome Browser
Species Human (GRCh38)
Location 9:16850624-16850646
Sequence CTGTGGAAGGTGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051416841_1051416850 -2 Left 1051416841 9:16850603-16850625 CCCATGCCTGTAATTCCACCACT 0: 1
1: 82
2: 1406
3: 2862
4: 3410
Right 1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG No data
1051416844_1051416850 -8 Left 1051416844 9:16850609-16850631 CCTGTAATTCCACCACTGTGGAA 0: 1
1: 8
2: 1035
3: 31032
4: 355522
Right 1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG No data
1051416842_1051416850 -3 Left 1051416842 9:16850604-16850626 CCATGCCTGTAATTCCACCACTG 0: 1
1: 3
2: 109
3: 1658
4: 3505
Right 1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051416850 Original CRISPR CTGTGGAAGGTGAAGGTGGA AGG Intronic
No off target data available for this crispr