ID: 1051417090

View in Genome Browser
Species Human (GRCh38)
Location 9:16853269-16853291
Sequence CCGTGGTGGCATGCAGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051417085_1051417090 1 Left 1051417085 9:16853245-16853267 CCATCTCTACAAAAAACTAGCTG 0: 3
1: 159
2: 383
3: 669
4: 1868
Right 1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG No data
1051417084_1051417090 17 Left 1051417084 9:16853229-16853251 CCAGCATGGCAAAACTCCATCTC 0: 12
1: 582
2: 7223
3: 23717
4: 83970
Right 1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG No data
1051417083_1051417090 22 Left 1051417083 9:16853224-16853246 CCTGGCCAGCATGGCAAAACTCC 0: 21
1: 832
2: 11399
3: 39549
4: 128012
Right 1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG No data
1051417082_1051417090 26 Left 1051417082 9:16853220-16853242 CCAGCCTGGCCAGCATGGCAAAA 0: 266
1: 14432
2: 41610
3: 139044
4: 203197
Right 1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051417090 Original CRISPR CCGTGGTGGCATGCAGCTGT AGG Intronic
No off target data available for this crispr