ID: 1051419721

View in Genome Browser
Species Human (GRCh38)
Location 9:16877316-16877338
Sequence GCCAGCAGGCCAGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051419721_1051419724 -8 Left 1051419721 9:16877316-16877338 CCGGGGCTTGCTGGCCTGCTGGC No data
Right 1051419724 9:16877331-16877353 CTGCTGGCCGATCCAATTGCGGG No data
1051419721_1051419730 28 Left 1051419721 9:16877316-16877338 CCGGGGCTTGCTGGCCTGCTGGC No data
Right 1051419730 9:16877367-16877389 CACCCACCCAGAACTCGTGCTGG No data
1051419721_1051419723 -9 Left 1051419721 9:16877316-16877338 CCGGGGCTTGCTGGCCTGCTGGC No data
Right 1051419723 9:16877330-16877352 CCTGCTGGCCGATCCAATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051419721 Original CRISPR GCCAGCAGGCCAGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr