ID: 1051421766

View in Genome Browser
Species Human (GRCh38)
Location 9:16896134-16896156
Sequence TCTCCAAGCTGGTTACCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051421764_1051421766 -7 Left 1051421764 9:16896118-16896140 CCTTGAGGATGCAAGTTCTCCAA No data
Right 1051421766 9:16896134-16896156 TCTCCAAGCTGGTTACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051421766 Original CRISPR TCTCCAAGCTGGTTACCTTG AGG Intergenic