ID: 1051424388

View in Genome Browser
Species Human (GRCh38)
Location 9:16918892-16918914
Sequence GTGTCTACAAAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4863
Summary {0: 5, 1: 121, 2: 651, 3: 1186, 4: 2900}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051424384_1051424388 -4 Left 1051424384 9:16918873-16918895 CCATGTTTGGTGAAACCCGGTGT No data
Right 1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900
1051424381_1051424388 27 Left 1051424381 9:16918842-16918864 CCATTTCTATACTGCTGTGAAGA No data
Right 1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG 0: 5
1: 121
2: 651
3: 1186
4: 2900

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051424388 Original CRISPR GTGTCTACAAAAAATTAGCT GGG Intergenic
Too many off-targets to display for this crispr