ID: 1051431071

View in Genome Browser
Species Human (GRCh38)
Location 9:16981044-16981066
Sequence GGGTAGAGTCAGATGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051431071_1051431077 2 Left 1051431071 9:16981044-16981066 CCCTACACCATCTGACTCTACCC No data
Right 1051431077 9:16981069-16981091 CTGAAATCAACTACTACTATTGG No data
1051431071_1051431078 10 Left 1051431071 9:16981044-16981066 CCCTACACCATCTGACTCTACCC No data
Right 1051431078 9:16981077-16981099 AACTACTACTATTGGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051431071 Original CRISPR GGGTAGAGTCAGATGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr