ID: 1051432046

View in Genome Browser
Species Human (GRCh38)
Location 9:16989325-16989347
Sequence ATGATGAAGAGGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051432046_1051432052 22 Left 1051432046 9:16989325-16989347 CCTTCCTCATTCCTCTTCATCAT No data
Right 1051432052 9:16989370-16989392 TATGCACTGGTGTATTAATCAGG No data
1051432046_1051432050 9 Left 1051432046 9:16989325-16989347 CCTTCCTCATTCCTCTTCATCAT No data
Right 1051432050 9:16989357-16989379 TGCCTTCTGTCACTATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051432046 Original CRISPR ATGATGAAGAGGAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr