ID: 1051432949

View in Genome Browser
Species Human (GRCh38)
Location 9:16999030-16999052
Sequence GGCTTAACCCCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051432949_1051432955 2 Left 1051432949 9:16999030-16999052 CCAGCTACTCAGGGGGTTAAGCC No data
Right 1051432955 9:16999055-16999077 GGGAATCGCTTGAACCCAGGAGG 0: 550
1: 26234
2: 91656
3: 154466
4: 196208
1051432949_1051432956 8 Left 1051432949 9:16999030-16999052 CCAGCTACTCAGGGGGTTAAGCC No data
Right 1051432956 9:16999061-16999083 CGCTTGAACCCAGGAGGCAGAGG 0: 9838
1: 44006
2: 89933
3: 127473
4: 130712
1051432949_1051432954 -1 Left 1051432949 9:16999030-16999052 CCAGCTACTCAGGGGGTTAAGCC No data
Right 1051432954 9:16999052-16999074 CAGGGGAATCGCTTGAACCCAGG 0: 1070
1: 44369
2: 138505
3: 213460
4: 174849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051432949 Original CRISPR GGCTTAACCCCCTGAGTAGC TGG (reversed) Intergenic
No off target data available for this crispr