ID: 1051433750

View in Genome Browser
Species Human (GRCh38)
Location 9:17007857-17007879
Sequence CTGTATAACCAGCTGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051433738_1051433750 25 Left 1051433738 9:17007809-17007831 CCTCTCGCTTACTCACACCTATG No data
Right 1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG No data
1051433743_1051433750 8 Left 1051433743 9:17007826-17007848 CCTATGGCTGTATGCGGGTTGGG No data
Right 1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG No data
1051433737_1051433750 26 Left 1051433737 9:17007808-17007830 CCCTCTCGCTTACTCACACCTAT No data
Right 1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051433750 Original CRISPR CTGTATAACCAGCTGAAGGA GGG Intergenic
No off target data available for this crispr