ID: 1051434180

View in Genome Browser
Species Human (GRCh38)
Location 9:17013287-17013309
Sequence GGGAATTCAGCATTTCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051434167_1051434180 5 Left 1051434167 9:17013259-17013281 CCCTTTGTTTGGATCCCCACCCT No data
Right 1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG No data
1051434168_1051434180 4 Left 1051434168 9:17013260-17013282 CCTTTGTTTGGATCCCCACCCTA No data
Right 1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG No data
1051434173_1051434180 -10 Left 1051434173 9:17013274-17013296 CCCACCCTACCTGGGGAATTCAG No data
Right 1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG No data
1051434172_1051434180 -9 Left 1051434172 9:17013273-17013295 CCCCACCCTACCTGGGGAATTCA No data
Right 1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051434180 Original CRISPR GGGAATTCAGCATTTCTTTG GGG Intergenic
No off target data available for this crispr