ID: 1051444286

View in Genome Browser
Species Human (GRCh38)
Location 9:17124096-17124118
Sequence CAGCAAGAGGAGAAGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051444281_1051444286 30 Left 1051444281 9:17124043-17124065 CCTTCTGTTGTCTAGAGTCTAAT No data
Right 1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051444286 Original CRISPR CAGCAAGAGGAGAAGAGGTC TGG Intergenic
No off target data available for this crispr