ID: 1051451884

View in Genome Browser
Species Human (GRCh38)
Location 9:17206173-17206195
Sequence TACCCCACCCCCATTGGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051451884_1051451886 0 Left 1051451884 9:17206173-17206195 CCGATACCAATGGGGGTGGGGTA 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1051451886 9:17206196-17206218 ATAACACTTGTAATCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051451884 Original CRISPR TACCCCACCCCCATTGGTAT CGG (reversed) Intronic
902176196 1:14652843-14652865 TACCCCGCCCCCATGGCAATTGG + Intronic
902770858 1:18644751-18644773 TCCTCCACCCCACTTGGTATTGG + Intronic
906389165 1:45398956-45398978 TACCCAACCTCCATTGGACTAGG + Intronic
918763900 1:188453630-188453652 TTGCCCAACCACATTGGTATAGG + Intergenic
919119096 1:193316669-193316691 TTCCCCTCCCCCATTGGAATAGG - Intergenic
923368434 1:233286344-233286366 TACCCCAACCCAAATGGTAGGGG - Intronic
924432782 1:244010757-244010779 CACCCCACCCCTATTTGTACAGG + Intergenic
1067565645 10:47334754-47334776 AACCCCACTCCCCTTGGAATTGG + Intergenic
1077400703 11:2355496-2355518 CACCCCTCCCCCAGTGGTACTGG + Intergenic
1077899724 11:6478707-6478729 TCCCCCACCCTCTTTGGTCTGGG + Intronic
1078825745 11:14928806-14928828 TACCCCTCCCCCAGTTGTAAGGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1090161231 11:124497811-124497833 TACCCCATCCCCCTTGGTAGGGG - Intergenic
1092217797 12:6694960-6694982 TGCCCCACCCTCAGTGGGATGGG + Exonic
1093098099 12:14995066-14995088 AGCCCCACCCCCAGTGATATTGG + Intergenic
1104157779 12:126150186-126150208 AACCCCACCCCTACTGGTCTAGG + Intergenic
1106448535 13:29858753-29858775 TACCCCACTCACATTGTTGTTGG - Intergenic
1107048963 13:36027172-36027194 CACCCCACCCCCATTTCTGTGGG - Intronic
1108926309 13:55750506-55750528 TACCTGACCCCCATTTGCATAGG - Intergenic
1112565348 13:100547293-100547315 TACCCCACCCCCTCTGGTCTGGG - Intronic
1120250817 14:82060308-82060330 CACCCCACCCCTAGTGGTATTGG - Intergenic
1120864772 14:89286372-89286394 CACCCCATCCCCGTTGGTTTGGG - Intronic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1121465993 14:94115883-94115905 AACTCCACCCCCATTGGCAATGG - Exonic
1125551635 15:40549482-40549504 TACCCCACTCCAACTGGTCTAGG + Intronic
1128449379 15:67794596-67794618 TACCCGACCCTCAGTGGAATGGG - Intronic
1128878490 15:71221932-71221954 CACCCCACACCCATTAGGATGGG - Intronic
1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG + Intronic
1135627387 16:24007956-24007978 TCCCCCACCTCCAGTGGTCTAGG + Intronic
1142144565 16:88487521-88487543 TCCCCCACCCCCGTTGGCCTTGG - Intronic
1146795022 17:35774628-35774650 TACCCCTCCCCCACTTGCATTGG - Intronic
1147041899 17:37725912-37725934 GACCCCATCCCCATTTGTGTGGG - Intronic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1149032915 17:52104147-52104169 GACCCCACCCTCCTTTGTATGGG - Intronic
1152026471 17:77812635-77812657 GAGCCCAACCCCATTGGTGTTGG - Intergenic
1152516194 17:80826251-80826273 TACCCCAGCCCCATTTTGATGGG + Intronic
1157714409 18:49873539-49873561 TCCACCACCACCAGTGGTATAGG + Intronic
1160344980 18:78124876-78124898 TTCCCCACCCCCACAGGTGTGGG + Intergenic
1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG + Intronic
927913912 2:26922047-26922069 TACCCCTGCCCCATAGGTCTGGG + Intronic
932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG + Intergenic
933266476 2:80186104-80186126 CACCCCACCCCCATCCCTATGGG + Intronic
937361915 2:121235387-121235409 CCCCCCACCCCCAGTGCTATGGG - Intronic
938418331 2:131123195-131123217 AACCCCATCCCCATATGTATGGG + Intronic
944174626 2:196816279-196816301 CCCTCCTCCCCCATTGGTATAGG + Intergenic
944699964 2:202238180-202238202 TACCCCACCGCCTTTGGTGGCGG - Intronic
947806660 2:232973437-232973459 TTCCCCAACCCCTTTGGTCTGGG + Intronic
948152928 2:235758720-235758742 CCCCCAACCCCCATTTGTATTGG - Intronic
948380874 2:237549294-237549316 TCCCCCACCCCCATGGGCCTGGG + Intronic
949743577 3:7263789-7263811 TACCCTACCGCCATTGCTGTGGG - Intronic
950190678 3:10974240-10974262 TGCCCCATCCCCCTTGGGATGGG + Intergenic
951416694 3:22432636-22432658 AACCCCACCCCCATACTTATAGG - Intergenic
959187555 3:103065445-103065467 TAGCCGACTCCCCTTGGTATTGG + Intergenic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
965758069 3:172045265-172045287 TACCCCACTCCTAATGGAATAGG + Intronic
970146214 4:13038736-13038758 TTCCCCAACCCCATTGATGTTGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971894899 4:32579789-32579811 TACCCCTCCCATATTGGTCTTGG + Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
978665705 4:111178494-111178516 TAGCCCACCCACATTGGGAAAGG - Intergenic
981456728 4:144961777-144961799 CACCCCACCCCCATTAACATGGG + Intergenic
984624605 4:181991826-181991848 AACCCCACCCCTATTTTTATAGG + Intergenic
988268740 5:28986524-28986546 TACTCCATTCCCATTGGTAGTGG - Intergenic
992885301 5:81152833-81152855 TACCCCATCTCCTTTAGTATGGG + Intronic
993556409 5:89345234-89345256 TACCCCACCCTGAAAGGTATAGG + Intergenic
997230640 5:132239844-132239866 CACCCCACCACCATTGGGACTGG + Intronic
1011197140 6:84793126-84793148 AACGCCATCCCCATTGATATTGG - Intergenic
1015638743 6:135307071-135307093 TACCGCTTCCCCATTGCTATAGG - Intronic
1023103955 7:36746022-36746044 TGCCCTCCCCCCATAGGTATGGG - Intergenic
1024875181 7:54013900-54013922 TGTCTCACCCCCATTGCTATTGG - Intergenic
1031768064 7:125806211-125806233 TTCCCCACCCACATTGGTGAAGG - Intergenic
1033026693 7:137781315-137781337 TACCCTCCCCCCATTGCTAAGGG - Intronic
1033625210 7:143104441-143104463 GACCCCACCCCCATTGGCCAAGG + Intergenic
1034991721 7:155551671-155551693 CACACAACCCCCATTGTTATTGG - Intergenic
1038572476 8:28674826-28674848 TTCCCAACCCTCAGTGGTATTGG + Intronic
1044588535 8:93890912-93890934 TACACTACACCCATTGGCATGGG + Intronic
1047565078 8:126035110-126035132 CTCCCCACCCACAGTGGTATTGG - Intergenic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1051761612 9:20472517-20472539 TGCCCAACCCCCAGTGGTAGGGG - Intronic
1054850580 9:69842969-69842991 TTCCCCACCCCCACTGGACTAGG - Intronic
1185791833 X:2933035-2933057 GACCCCACTCCTATTGGAATAGG - Intergenic
1186149254 X:6656647-6656669 TATCACACCCCTACTGGTATTGG + Intergenic
1186566398 X:10667293-10667315 TACCCCACCCCCACTCATGTAGG - Intronic
1194152523 X:90343581-90343603 TGCCCCACTCCCAGTGGTACTGG + Intergenic
1194870523 X:99125899-99125921 ATCCCCACCCACAGTGGTATTGG + Intergenic
1195727266 X:107931475-107931497 TACCCCACGCCTGTTTGTATTGG + Intergenic
1197028328 X:121782594-121782616 TAACCAACACCTATTGGTATTGG + Intergenic
1200498871 Y:3920330-3920352 TGCCCCACTCCCAGTGGTACTGG + Intergenic
1201281823 Y:12349238-12349260 GACCCCACTCCTATTGGAATAGG + Intergenic
1202151185 Y:21845115-21845137 TACCCCAATCCCATGGGGATTGG + Intergenic