ID: 1051452888

View in Genome Browser
Species Human (GRCh38)
Location 9:17216779-17216801
Sequence GGCTTAATACACATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051452888_1051452895 -4 Left 1051452888 9:17216779-17216801 CCCTGTCCCATGTGTATTAAGCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1051452895 9:17216798-17216820 AGCCAACATAGGCTGCAAAGGGG No data
1051452888_1051452893 -6 Left 1051452888 9:17216779-17216801 CCCTGTCCCATGTGTATTAAGCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1051452893 9:17216796-17216818 TAAGCCAACATAGGCTGCAAAGG No data
1051452888_1051452894 -5 Left 1051452888 9:17216779-17216801 CCCTGTCCCATGTGTATTAAGCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1051452894 9:17216797-17216819 AAGCCAACATAGGCTGCAAAGGG No data
1051452888_1051452897 7 Left 1051452888 9:17216779-17216801 CCCTGTCCCATGTGTATTAAGCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1051452897 9:17216809-17216831 GCTGCAAAGGGGTTGCAGTTTGG No data
1051452888_1051452898 25 Left 1051452888 9:17216779-17216801 CCCTGTCCCATGTGTATTAAGCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1051452898 9:17216827-17216849 TTTGGAGCATGATAGTAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051452888 Original CRISPR GGCTTAATACACATGGGACA GGG (reversed) Intronic
900976700 1:6021295-6021317 GGCTCAATAAACATGGCACATGG - Intronic
905744416 1:40402163-40402185 TGTTTAATACACATTGGTCATGG - Intronic
908749301 1:67404264-67404286 GGCAAAAGAAACATGGGACAGGG - Intergenic
909023582 1:70459357-70459379 TGCTTAGTACACCTGGCACATGG + Intergenic
909800486 1:79801514-79801536 GGCTTAATTTATAGGGGACAGGG + Intergenic
911282477 1:95947907-95947929 AGATTAATACACATTGCACATGG + Intergenic
912718878 1:112003183-112003205 GCCTGAAAACACATGAGACAAGG + Intergenic
913361396 1:117984397-117984419 GGCTTAACATAGATGGGAGAGGG + Intronic
917025330 1:170635730-170635752 AACTTAATAGACATGGAACATGG + Intergenic
920291877 1:204929167-204929189 GGCTAAGTTCACATGGGTCAGGG - Intronic
921881051 1:220254327-220254349 CGCTCCATACACCTGGGACATGG - Intronic
922330732 1:224573335-224573357 GGCTTAAAACACAAGGTGCAAGG + Intronic
923216044 1:231848781-231848803 GGCATAATATGCAAGGGACAGGG - Intronic
1065348918 10:24777911-24777933 TTCTTAATCAACATGGGACATGG + Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1066488744 10:35873774-35873796 GGCCTCATACTCATGGCACAAGG - Intergenic
1073920513 10:108452836-108452858 TGATTCATACACATGGGTCAGGG + Intergenic
1076790235 10:132773133-132773155 GGCTGAGTGCACACGGGACATGG - Intronic
1088799579 11:113293212-113293234 GCCTTGATACAAATGGGACATGG + Intergenic
1093132236 12:15405513-15405535 TGGTTAATACAAATGGGAAAAGG + Intronic
1094075686 12:26471262-26471284 GGTTTAATATATATTGGACATGG + Intronic
1098304713 12:69090984-69091006 GGCTGCATTCACATGGGACCTGG - Intergenic
1100715155 12:97297738-97297760 GGCCTAATAATCAAGGGACATGG + Intergenic
1102951530 12:117034686-117034708 GGCTTGCTGCACTTGGGACAGGG + Intergenic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1120688552 14:87566534-87566556 CGCTTAATACATATGGGGTAGGG + Intergenic
1120741441 14:88113139-88113161 GGGTTAATACACTTAGGATAGGG + Intergenic
1125311618 15:38385245-38385267 GGCTCATTACACATGGTTCATGG + Intergenic
1125478862 15:40066408-40066430 AGCTTAATACACATGACATATGG + Intergenic
1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG + Intronic
1129864445 15:78894186-78894208 CGCTCCATACACCTGGGACATGG - Exonic
1130620814 15:85460462-85460484 GGCTCAATAAACATGGAGCAAGG - Intronic
1137882901 16:52070983-52071005 GGCTAAATACACATTGTATAAGG + Intronic
1138597756 16:58038255-58038277 CGCTTCATCCACCTGGGACATGG - Exonic
1149140339 17:53425622-53425644 GGCTTAATAAACCTGGGATGGGG - Intergenic
1155926057 18:31656383-31656405 GGCTTAAAAATCATGGGGCAGGG + Intronic
1157692471 18:49694802-49694824 GGCCAGAGACACATGGGACATGG + Intergenic
1160103236 18:75944118-75944140 GGCTTATTCCAAATGGAACATGG + Intergenic
1163026752 19:14517352-14517374 GGCTAAAGACACATGGTCCAGGG + Intronic
926943190 2:18159674-18159696 GGCAGAATCCACATGGGAAAAGG + Intronic
935538370 2:104321191-104321213 GGCCTATGACACATGGGACAGGG + Intergenic
944276982 2:197850288-197850310 GGCTTAATTACCTTGGGACAAGG - Intronic
944986910 2:205187792-205187814 GGCCTAAAACACACGGGACTAGG - Intronic
945933897 2:215883688-215883710 AGCTTCAGACACCTGGGACACGG + Intergenic
946155422 2:217803780-217803802 GTCTACAAACACATGGGACAAGG + Exonic
947134534 2:226964019-226964041 GGCTGAAGACACAAGGGAAAAGG - Intronic
948175504 2:235939610-235939632 GGCTGATGACACATGGGAGAGGG - Intronic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1174502999 20:50999368-50999390 TGTTTAATACACTGGGGACATGG + Intergenic
1174598652 20:51706161-51706183 GCCTTAATACATATGCTACAGGG - Intronic
1177990070 21:28026773-28026795 GGCTTGAAACACGTGGTACAGGG - Intergenic
1181451216 22:23022990-23023012 GGCTTAAAACACATAATACATGG - Intergenic
1182824646 22:33254238-33254260 GGCTAACTAGAAATGGGACATGG + Intronic
1183955219 22:41376008-41376030 GGCTTACTGAAAATGGGACATGG - Intronic
949337771 3:2994831-2994853 GGCTTTATACAGATTTGACAGGG + Intronic
949426478 3:3922572-3922594 GTCATAAGACACATGGTACAGGG + Intronic
949621578 3:5818706-5818728 GGCTGAAAACACAAGTGACATGG - Intergenic
950405924 3:12804485-12804507 GGCTTAGGGCACATGGGACTGGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950500689 3:13361735-13361757 AGTTTAATGCACAAGGGACAGGG - Intronic
950528631 3:13539735-13539757 TGCTTAGTAGACATGGGACCTGG - Intergenic
958516717 3:95125788-95125810 AGGTCAATATACATGGGACATGG + Intergenic
960969120 3:123126595-123126617 GGCTTAATCCATGTGGGACCGGG - Intronic
969255460 4:5998784-5998806 GGCTCACTGCACCTGGGACATGG + Intergenic
972998544 4:44915011-44915033 GACTTAATAAACAGAGGACATGG - Intergenic
975357079 4:73419729-73419751 GGCTTTGTACATGTGGGACAGGG + Intronic
975393271 4:73845551-73845573 GGCCTCATTCACATGGGACGTGG - Intronic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
986211541 5:5678187-5678209 GGCCTAATACACATCAGATAAGG - Intergenic
986852597 5:11830542-11830564 GGCCTAATAAACATGGCAGAAGG - Intronic
998424413 5:142014318-142014340 GGCTTTATGCCCACGGGACAGGG + Intergenic
1010567703 6:77437098-77437120 GGCTAAATACACTTGGTAAAAGG - Intergenic
1019202249 6:170327514-170327536 GGCTTTATACACACTGCACACGG + Intronic
1019901647 7:4025844-4025866 GGCCTAACTCACATGTGACAGGG - Intronic
1026500452 7:70939058-70939080 GGCCTAATACACATGGAAAGGGG + Intergenic
1029815034 7:103084906-103084928 GCCTCAATAAACATGGGCCATGG - Intronic
1031675333 7:124603231-124603253 GGCTTCTTACAGATGAGACAAGG + Intergenic
1033211538 7:139463624-139463646 GGTCCCATACACATGGGACACGG - Intronic
1033894394 7:146053608-146053630 GACTGATTACACATGGGTCAAGG - Intergenic
1035964350 8:4173897-4173919 GGCTCAGTACACATGGCTCAGGG + Intronic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1036598986 8:10241531-10241553 GGTACAATTCACATGGGACAGGG - Intronic
1037207484 8:16340553-16340575 GGCATAATACACATGAGAATGGG - Intronic
1037528945 8:19755968-19755990 TGCATAATACACAGGGGACTAGG - Intronic
1044119040 8:88371319-88371341 AGGTTAATAAACATAGGACATGG - Intergenic
1050479403 9:6074237-6074259 GGCTTATTCCACATGGGACAGGG - Intergenic
1051452888 9:17216779-17216801 GGCTTAATACACATGGGACAGGG - Intronic
1053078443 9:35154610-35154632 GGTCTCATACAGATGGGACACGG + Intergenic
1054862312 9:69966652-69966674 GGCAGAAACCACATGGGACAGGG - Intergenic
1056518905 9:87381846-87381868 GGCCTTATGCACATGGGTCAGGG - Intergenic
1059150275 9:111943266-111943288 GGCTTAATACTAGTGAGACAGGG - Intergenic
1062568334 9:137173064-137173086 AGCTCAGGACACATGGGACACGG + Intergenic
1187653632 X:21442557-21442579 AGCTTAAAATACATGGGGCAAGG + Intronic
1188829577 X:34880155-34880177 GTCTTCATACAAATGGGTCATGG + Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1192701121 X:73474624-73474646 TGCTCCATACACCTGGGACATGG - Intergenic
1192765601 X:74136918-74136940 GTCTTATTACAAATGGGCCATGG - Intergenic
1198330740 X:135620031-135620053 GTCTTTACAAACATGGGACATGG + Intergenic
1200355399 X:155544687-155544709 GCCTTAATATACAAGGGAGAGGG - Intronic