ID: 1051459991

View in Genome Browser
Species Human (GRCh38)
Location 9:17301197-17301219
Sequence GTGTATGTCTTTACTAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051459986_1051459991 12 Left 1051459986 9:17301162-17301184 CCAAATGGACTCTAGTTCAAACC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 1051459991 9:17301197-17301219 GTGTATGTCTTTACTAAATTGGG 0: 1
1: 0
2: 2
3: 27
4: 243
1051459987_1051459991 -9 Left 1051459987 9:17301183-17301205 CCAGAAATTCCCTAGTGTATGTC 0: 1
1: 0
2: 1
3: 4
4: 114
Right 1051459991 9:17301197-17301219 GTGTATGTCTTTACTAAATTGGG 0: 1
1: 0
2: 2
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051459991 Original CRISPR GTGTATGTCTTTACTAAATT GGG Intronic
902350983 1:15854200-15854222 GTGTATATATTCATTAAATTGGG + Intronic
903142334 1:21346071-21346093 GTGTGTGTGTTTGCTATATTTGG + Intergenic
904673629 1:32183911-32183933 GTGTATGTCTTTAGTAGAGATGG + Intronic
905819167 1:40976378-40976400 GTGTATGTATTTACATATTTGGG - Intergenic
907561602 1:55395320-55395342 ATGTATGTCTTTACTAAATATGG + Intergenic
909314131 1:74194668-74194690 GTGAATGTTTTTATTAATTTTGG - Intronic
911330594 1:96521602-96521624 GTGCATGTTTTAACTAAGTTTGG + Intergenic
911863552 1:102987224-102987246 GTATATGTCTATATTAAATAGGG - Intronic
912421470 1:109544958-109544980 GTGTATTCCTTTACTGAGTTTGG + Exonic
912771928 1:112472082-112472104 GTCAATGTCTTTAATATATTTGG - Intronic
912976287 1:114333676-114333698 GTGTTTGACTTTATTAAACTTGG + Intergenic
914433146 1:147637877-147637899 TTGTATGTCTTCAGTAAATGTGG + Intronic
914797983 1:150937874-150937896 GTGTATGTGTATACCACATTTGG - Intronic
915030466 1:152876116-152876138 ATGTATTTATTTACTAAATGTGG + Intergenic
915600378 1:156919917-156919939 GGGTATGCCTTTACTCAAATGGG + Intergenic
916976487 1:170085767-170085789 GTGTATATCCCTACTGAATTTGG - Intergenic
917693523 1:177493901-177493923 ATGTATGTATTTACTTATTTAGG - Intergenic
919983461 1:202657079-202657101 GTGTATGTCCTTTTTAAAATGGG + Intronic
920878217 1:209856977-209856999 GTGTATGTCAAAGCTAAATTAGG + Exonic
922129795 1:222766405-222766427 CTGTATTTCTTTATAAAATTTGG + Intergenic
923074251 1:230595251-230595273 GTGGATTTCTTTATTAAGTTGGG - Intergenic
924205732 1:241709650-241709672 GTGTATCTCTTTACAAAAACTGG - Intronic
1064233414 10:13550323-13550345 GTTTATGTTTTTACTAAATCTGG - Intergenic
1064834362 10:19509408-19509430 GTTTATTTCTGTACTAAGTTAGG + Intronic
1064865065 10:19870192-19870214 CTGTCTATCTTTACTTAATTTGG - Intronic
1067244724 10:44529662-44529684 GTGTATTTCTTTAAAATATTTGG + Intergenic
1071160579 10:82740938-82740960 GTGTATTTCTTTTCTACATTTGG - Intronic
1072846689 10:98839065-98839087 CAGTATGTCTTTACTAATGTAGG + Intronic
1074579128 10:114700293-114700315 ATATATATCTTTACTAATTTAGG - Intergenic
1074862489 10:117522469-117522491 GTGTACGTCTTTAATACATCTGG - Intergenic
1076977744 11:187952-187974 GTTTGTTTCTATACTAAATTAGG - Intronic
1078318370 11:10310398-10310420 GTGTATATTTTAACTATATTTGG - Intronic
1081492033 11:43576768-43576790 GTGTATGTGTATAATGAATTTGG + Intronic
1083848241 11:65349392-65349414 GTGAATAGCTTTAATAAATTTGG - Intronic
1086894928 11:92301252-92301274 CTGTATGTCCTTACTACATTTGG - Intergenic
1087439666 11:98166448-98166470 GTGTTTTTTTTTTCTAAATTTGG + Intergenic
1087803586 11:102531412-102531434 GTTTATGTCTTTTCTTAATGGGG + Intergenic
1090180382 11:124693160-124693182 GTGTATTTGTTTGCTATATTAGG + Intronic
1094803034 12:34060198-34060220 GGGGATGTATTTACTTAATTGGG + Intergenic
1095116440 12:38358699-38358721 GGGGATGTATTTACTTAATTGGG + Intergenic
1096890419 12:54764535-54764557 GTTTATGTCTGAACTAAATGAGG + Intergenic
1097384769 12:58937334-58937356 GTATATGTCTCTACTTATTTAGG - Intergenic
1097570331 12:61324553-61324575 GTTTAAGTCTTTAATCAATTTGG - Intergenic
1099134400 12:78877507-78877529 GTGTATGCATACACTAAATTTGG - Intronic
1100865159 12:98849928-98849950 ATGTATGTCTTTGGTTAATTTGG + Intronic
1100900091 12:99228959-99228981 TTATATTTGTTTACTAAATTTGG + Intronic
1100957460 12:99924829-99924851 GTGTTTGTCTTTAGTCTATTTGG - Intronic
1102534555 12:113570861-113570883 ATGCATGTATTTACAAAATTGGG + Intergenic
1102974838 12:117199138-117199160 GTGTATCTCTTTTCTAAAACAGG - Intergenic
1104445616 12:128830930-128830952 GTGTATTTGTTTTCTAGATTAGG + Intergenic
1104683361 12:130767501-130767523 GAGTCTGTCTTTAATAAATGTGG + Intergenic
1105272316 13:18889160-18889182 GTGTATGTGTGTTTTAAATTTGG - Intergenic
1106638353 13:31555896-31555918 GTGTATGACTTTACTAAGTGTGG - Intergenic
1108845351 13:54671901-54671923 GGTTATGCCTTTACAAAATTTGG + Intergenic
1109354991 13:61224216-61224238 GTGTATGTCCTTGCGATATTGGG - Intergenic
1109367872 13:61381142-61381164 GTGTATGTTTTTAGTACCTTTGG - Intergenic
1110335794 13:74328574-74328596 GTGTATCTTTTTATGAAATTTGG + Intergenic
1111319559 13:86609286-86609308 GTTTGTGGCTTTACTATATTTGG + Intergenic
1115967549 14:38909026-38909048 GTGTTTGTATTTGCTAAATCTGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118472380 14:66086692-66086714 GTGTCTGCCTCTACTATATTTGG - Intergenic
1119722618 14:76901435-76901457 TTGTATGGCTTTACCATATTTGG - Intergenic
1120328040 14:83053909-83053931 GTGAAAGGCTTTTCTAAATTTGG - Intergenic
1121547196 14:94770873-94770895 GTTTTTGCCTTTACAAAATTTGG - Intergenic
1125198217 15:37072860-37072882 GTGGAAGTCTTCACAAAATTCGG - Intronic
1126254313 15:46607419-46607441 GTCTATGTCTTTACTAAACTGGG + Intergenic
1127824546 15:62691130-62691152 GTTTAAGTCTTCACTAATTTGGG + Intronic
1128126386 15:65196214-65196236 ATTTATTTCTTTGCTAAATTTGG - Exonic
1129415571 15:75375975-75375997 GTGTATGTATTTAACAAATTGGG - Intronic
1131084353 15:89563694-89563716 GTGTATCTCTTCACTTAGTTAGG - Intergenic
1133982815 16:10646187-10646209 GTATTTGTCTTTGCTAAATCTGG + Intronic
1136123382 16:28157008-28157030 GTTTAAGTCTTTACTTCATTTGG - Intronic
1138225064 16:55286885-55286907 GTATTTGTATTTGCTAAATTTGG - Intergenic
1138302210 16:55940784-55940806 GTGTATGTGTTTTTTTAATTTGG - Intronic
1140720319 16:77765628-77765650 GTGTCTTTATTTACTAAATCTGG - Intergenic
1141288190 16:82692297-82692319 GGGTATGTCTTTACTAAGCAGGG - Intronic
1142442585 16:90109376-90109398 GTTTGTTTCTATACTAAATTAGG + Intergenic
1142465164 17:132417-132439 GTTTGTTTCTATACTAAATTAGG - Intergenic
1143361920 17:6378277-6378299 GTTTATGTCTTCATGAAATTTGG + Intergenic
1143380395 17:6492396-6492418 GTGTTTGTATTGACTAAAATAGG - Intronic
1144172828 17:12676100-12676122 CTGTAAGTCTTTAATAAAGTAGG + Intronic
1149653350 17:58292902-58292924 GTCTATGTCTTTGCCAAATTTGG - Intergenic
1149907839 17:60542955-60542977 GTGTATGTTTTTGCTACCTTGGG - Intergenic
1155012525 18:21793972-21793994 GTGGATGTCTGCACTAAGTTCGG + Intronic
1155823587 18:30409426-30409448 GTTTATGTTTTGACAAAATTAGG - Intergenic
1156746038 18:40392568-40392590 GTGTAAGTCATTAGTAAATGTGG - Intergenic
1157089386 18:44618301-44618323 GTGTATGTCTTCAATAAATGGGG + Intergenic
1157458412 18:47860184-47860206 GTGTATGTGTTTGATAAACTTGG - Intronic
1159232957 18:65633125-65633147 GTATTTTTCTTTGCTAAATTTGG - Intergenic
1161920849 19:7264654-7264676 GTGTATGTCTTGCATAAATTTGG + Intronic
1165468250 19:35987669-35987691 GTGTATGTCTTTAAAAGATAAGG + Intergenic
925834018 2:7925511-7925533 CTCTATGTCTTTACTACATTAGG + Intergenic
926596356 2:14793676-14793698 AAGTATGACTTTACCAAATTTGG - Intergenic
926678809 2:15648852-15648874 GTGTGTGTCTTTTATAATTTTGG + Intergenic
927465752 2:23335357-23335379 GTGTCTGTCTTTGCTGAGTTTGG - Intergenic
928143868 2:28753682-28753704 GTGTATGTCTTGTTTACATTTGG + Intronic
929409486 2:41681342-41681364 GTTGACATCTTTACTAAATTAGG + Intergenic
929502385 2:42501579-42501601 GTGTTTGACTTTACTGCATTGGG - Intronic
929672829 2:43891269-43891291 GTGTGTGTTACTACTAAATTAGG - Intronic
930408577 2:50994855-50994877 TTGTATGTGTTTACTAAGTAAGG - Intronic
930459503 2:51654445-51654467 GTGCAAGTCTGTATTAAATTTGG + Intergenic
930913506 2:56659945-56659967 GTCTATTCCTTTAATAAATTTGG - Intergenic
931329544 2:61266218-61266240 GTGTATATGTTAACTATATTTGG - Intronic
935595649 2:104875198-104875220 TTGTGTGTATTTACTACATTTGG + Intergenic
935873966 2:107486240-107486262 GTTTATGTTTTTAAAAAATTTGG + Intergenic
937331765 2:121035001-121035023 GTGTCTTTATTTACTAAATCTGG - Intergenic
938885484 2:135643583-135643605 GTATTTTTCTTTACTAAAATTGG - Intronic
939701498 2:145398185-145398207 CAGTATGACTTCACTAAATTTGG - Intergenic
939738937 2:145882433-145882455 GTGAATGTCTTTAATATATGAGG - Intergenic
940283633 2:152012036-152012058 GTTTATATATTTACTAAACTAGG + Intronic
940514555 2:154665611-154665633 GTGTATCTATTTGCTAAAATTGG - Intergenic
940759569 2:157722614-157722636 GTATAAGTCTTTATCAAATTTGG - Intergenic
940780798 2:157931750-157931772 GTGTGTGTGTGTACTGAATTAGG - Intronic
941476690 2:165958049-165958071 GTATATGTCATCATTAAATTTGG + Intergenic
941800890 2:169658523-169658545 GAGTATAACTTTACTAATTTGGG + Intronic
943164999 2:184311109-184311131 GTGTATGTGTTTAGGAATTTGGG - Intergenic
943267401 2:185751760-185751782 GTATATGTCTTTAATTTATTAGG + Intronic
943337306 2:186632333-186632355 GTGAAAGTCATTGCTAAATTAGG + Intronic
943473386 2:188323686-188323708 GTGTATGTGTGTACAAAGTTAGG + Intronic
944002576 2:194858138-194858160 ATGTATGTTTTTACCACATTAGG + Intergenic
944032260 2:195249620-195249642 TTAAATGTGTTTACTAAATTGGG + Intergenic
944791704 2:203136978-203137000 GTTTAAGTCTTAAGTAAATTTGG + Intronic
945551547 2:211227285-211227307 TTGTATGTATGTACTACATTTGG + Intergenic
948272017 2:236681784-236681806 GTGTATTTATTTGCTAAATCTGG - Intergenic
1169884450 20:10382983-10383005 GTGTATATTTTTTCTAAACTGGG + Intergenic
1170385078 20:15807424-15807446 GTGTGTGTATGTACTAAAGTAGG - Intronic
1174370103 20:50080989-50081011 GTCTATATATTTACTAATTTAGG + Intergenic
1175651934 20:60732604-60732626 GTGTATGAGTTTACTTACTTGGG - Intergenic
1176669152 21:9715928-9715950 GTGTATTTTTATGCTAAATTTGG - Intergenic
1176674258 21:9763142-9763164 GTGCATGTATTTTTTAAATTGGG + Intergenic
1178249667 21:30990408-30990430 ATGTTTGTCTTTTCTAAAATGGG - Intergenic
1179915463 21:44474981-44475003 GTGGACGTCTTTACTGAATTGGG + Intergenic
1185124400 22:48998956-48998978 GTGTATGCCCTTTTTAAATTTGG + Intergenic
950130577 3:10542869-10542891 TTGTGTGTTTTTACCAAATTTGG + Intronic
951389023 3:22080154-22080176 GTCTATGTCTTTAATAATATGGG + Intronic
951399156 3:22209497-22209519 GTGTATTTATATACTAAATATGG + Intronic
951420603 3:22479691-22479713 GTGTGTGTATTTACTATATAAGG - Intergenic
951597967 3:24338517-24338539 GAGTATGTATTTACTCAATGTGG - Intronic
952068535 3:29603254-29603276 CTGTATGATTTTAATAAATTAGG - Intronic
952868119 3:37871645-37871667 GTTTATGTCTTTGCTAAACTGGG + Intronic
953108657 3:39910541-39910563 GAGTATGTCTTATCCAAATTGGG + Intronic
956316767 3:67946802-67946824 GTGAATTGCTTAACTAAATTAGG + Intergenic
957147097 3:76438521-76438543 GTCTATGGCTTTACAATATTAGG - Intronic
958182355 3:90076398-90076420 GTGTGTGTCTATACCAAAGTAGG + Intergenic
961905254 3:130256463-130256485 TTCTATGTGTTTACTCAATTGGG + Intergenic
962172049 3:133111701-133111723 GTGTATGTGTTGACTACAGTTGG - Intronic
962451906 3:135526599-135526621 GTTTATGTCTTTACAAAGGTTGG + Intergenic
963982591 3:151556538-151556560 CTGTATTTCTTTAACAAATTTGG - Intergenic
964576304 3:158172831-158172853 ATTTATTTCATTACTAAATTAGG - Intronic
965366054 3:167801324-167801346 TTGTATGCCTTTATTAAAATAGG + Intronic
965500746 3:169453553-169453575 GAGTACTTCTTTACTAAATTGGG + Intronic
965993751 3:174853059-174853081 ATGTAAGTCTTTAATCAATTTGG - Intronic
966105528 3:176328588-176328610 TTGTATATCTTTATTATATTTGG + Intergenic
968362858 3:198160336-198160358 GTTTGTTTCTATACTAAATTAGG + Intergenic
969104143 4:4792173-4792195 GTGGGTGTCTTCACTAAATGTGG - Intergenic
971241726 4:24895479-24895501 GTATCTGTATTTTCTAAATTTGG + Intronic
973631204 4:52822580-52822602 GTGTATGACTATACTATAATTGG + Intergenic
974335012 4:60531344-60531366 GTGTATGTCTTTGCTATACATGG + Intergenic
976699953 4:87959328-87959350 TGGTCTGTTTTTACTAAATTTGG + Intergenic
976826861 4:89270474-89270496 CTGTATGTATTTACCATATTTGG + Intronic
977330068 4:95626464-95626486 GTGTATGTATTTGGTAAATGTGG - Intergenic
977448206 4:97158934-97158956 GTGTCTGACTTTGGTAAATTAGG - Intergenic
977979077 4:103301702-103301724 GTGTATGTCTGTTCTAAGTATGG + Intergenic
979107541 4:116706373-116706395 ATGTAACTCATTACTAAATTAGG - Intergenic
979310244 4:119194427-119194449 GTGTATTTCTTAAATAAATGTGG - Intronic
979549091 4:121970186-121970208 GTTTTTTTCTTTACTACATTTGG + Intergenic
981882945 4:149637384-149637406 GTGTATCTCTTTATTAATTTAGG - Intergenic
982874567 4:160629739-160629761 TTGAATGTGTTTACAAAATTAGG + Intergenic
982988779 4:162244391-162244413 TAGTATATCTTTACTTAATTAGG - Intergenic
983722452 4:170872805-170872827 GTAAATGTATTTACTCAATTTGG + Intergenic
983848990 4:172556430-172556452 GTTTATTTATTTGCTAAATTGGG - Intronic
984028895 4:174578608-174578630 GTGTTTTTATTTGCTAAATTTGG - Intergenic
984575488 4:181442905-181442927 GTATTTGTTTGTACTAAATTAGG + Intergenic
984692499 4:182743418-182743440 AGGTACGTCTTTCCTAAATTTGG + Exonic
985149561 4:186932459-186932481 GTGTTTGTCTTTATTCACTTGGG + Intergenic
985218564 4:187678329-187678351 GAGCATGTATTTAATAAATTGGG - Intergenic
985405626 4:189635589-189635611 GTGTATTTTTATGCTAAATTTGG + Intergenic
986314034 5:6574256-6574278 GTATTTGTATTTGCTAAATTTGG + Intergenic
988238950 5:28583057-28583079 ATTCATGTCTTTATTAAATTTGG - Intergenic
991696093 5:69274235-69274257 ATGGATGTCTTTATTAAAGTTGG + Intronic
993065065 5:83087794-83087816 GTGTATGTCTCTTCTTTATTTGG + Intronic
993601896 5:89936276-89936298 TTTTCTGTCTGTACTAAATTGGG - Intergenic
993682215 5:90893660-90893682 ATGTATGTATTTAATAATTTTGG + Intronic
994756723 5:103802294-103802316 GTTTTTGTCTTTACAAAATAAGG - Intergenic
994905263 5:105832884-105832906 GTATATATCTTTACCAAATGTGG - Intergenic
994916401 5:105985370-105985392 GTGTATTTCTTTATTTAATTAGG - Intergenic
996445361 5:123542878-123542900 GTGTGTGTGTTTACCAAATTTGG + Intronic
996953748 5:129159025-129159047 GTGTATGTCTTTAATCTATCTGG + Intergenic
997043438 5:130285198-130285220 TTCCATGTCTTTGCTAAATTTGG - Intergenic
1000455562 5:161444219-161444241 GGGTATGTCTTTATGTAATTTGG - Intronic
1003079856 6:3013281-3013303 GTGGATATCTTTACCCAATTAGG - Intronic
1004363041 6:14987832-14987854 GTGTATGTCTTTTTAAAAATTGG + Intergenic
1004798805 6:19121283-19121305 ATCTATATCTTTACTAATTTTGG - Intergenic
1004892231 6:20112332-20112354 GTTTATGACTTTTGTAAATTTGG - Intronic
1005199615 6:23328756-23328778 GTGTATGTCTTTATTGGTTTAGG + Intergenic
1005296550 6:24432936-24432958 GTTCATGGCTTTACAAAATTAGG + Intronic
1009830903 6:68932496-68932518 ATGTTTGTCTATACTATATTTGG - Intronic
1010806988 6:80248979-80249001 GTGTATGTCTTCAGTGTATTTGG + Intronic
1012181055 6:96153191-96153213 ATGTATTTCTTTACCAAATTTGG - Intronic
1012589404 6:100961448-100961470 GGCTATTTCTTTACTAATTTTGG + Intergenic
1013552715 6:111224373-111224395 GTGTTTTTCTTTTCAAAATTTGG + Intronic
1013725313 6:113088338-113088360 GTATATGTCTTTTATAAATTTGG - Intergenic
1014002689 6:116382599-116382621 GTTTCTGTCTTCTCTAAATTTGG + Intronic
1014335298 6:120126299-120126321 GTGAAAGTGTTTACTAAATAGGG - Intergenic
1014368693 6:120578153-120578175 GTGTATTTTCATACTAAATTAGG + Intergenic
1014991766 6:128088646-128088668 TTATATGTTTTTGCTAAATTAGG + Intronic
1015687602 6:135882540-135882562 GTGTATGTATTTATTGAATAAGG - Intronic
1017851127 6:158307054-158307076 GTTTATGTTTTTAATAAATTAGG - Intronic
1018494496 6:164336084-164336106 TTGTATGTCTCTATTTAATTCGG + Intergenic
1019252825 7:28375-28397 GTTTGTTTCTATACTAAATTAGG - Intergenic
1021178581 7:17479460-17479482 GTTTAAGGCTGTACTAAATTGGG + Intergenic
1021546058 7:21814132-21814154 TTGTATATCTTTTCTATATTTGG - Intronic
1023558290 7:41446177-41446199 GTCTTTGTCTTTCCTGAATTTGG + Intergenic
1024754255 7:52510869-52510891 GCTTATGTCTTTTCTAAATTTGG + Intergenic
1025830955 7:65049403-65049425 GTGTATGTTTTTACTAGAGATGG + Intergenic
1025970293 7:66317461-66317483 TTGTTTGTTTTTGCTAAATTTGG + Intronic
1027716026 7:81671105-81671127 GTATATGTCATAAGTAAATTAGG - Intergenic
1027751461 7:82152523-82152545 GTGTTTTTCTGTACTAAATCTGG + Intronic
1028067256 7:86402248-86402270 GTATAGGTGCTTACTAAATTTGG + Intergenic
1032369371 7:131330963-131330985 GTGTATTTAATTATTAAATTAGG - Intronic
1035877718 8:3209778-3209800 TTGTATGTCTTTATTCATTTAGG - Intronic
1036567461 8:9949682-9949704 CTGTCTGTCTTTCCTAAATATGG + Intergenic
1036762724 8:11521594-11521616 ATTTATGTCTTTAATCAATTTGG + Intronic
1037174243 8:15928575-15928597 ATGTTTTTCTTTTCTAAATTGGG - Intergenic
1037256714 8:16963834-16963856 GTATATATGTTTACTAAAATTGG - Intergenic
1037310223 8:17547814-17547836 GTGTGTGTGTTTACAAAATTTGG + Intronic
1039198876 8:35063881-35063903 GTGTATTTCTTAACTTATTTTGG - Intergenic
1040768681 8:50947191-50947213 GTGTATGCCTATGCTTAATTGGG + Intergenic
1040975376 8:53188193-53188215 GTGAAAGTCTTTACTCAAGTAGG + Intergenic
1041146614 8:54882801-54882823 GTGTGTGTATTTACTACACTTGG + Intergenic
1041409682 8:57539781-57539803 TTGCATTTCTTTACTGAATTTGG - Intergenic
1043359207 8:79451399-79451421 ATGTATTTCTATACAAAATTTGG + Intergenic
1045528396 8:102961281-102961303 TTGTTTGTTTTTGCTAAATTTGG + Intronic
1046264269 8:111811090-111811112 TTGTTTGTCTTTACTAAATAGGG - Intergenic
1046686213 8:117230120-117230142 GTGTCTGGCTATAATAAATTAGG - Intergenic
1050245216 9:3682162-3682184 GTGTACATCGTTGCTAAATTTGG + Intergenic
1051031318 9:12683508-12683530 ATTTATGTCTTTAATCAATTTGG + Intergenic
1051459991 9:17301197-17301219 GTGTATGTCTTTACTAAATTGGG + Intronic
1051756181 9:20403279-20403301 CTGTATGTGATTTCTAAATTTGG + Intronic
1052505094 9:29343101-29343123 TTGTATGTCTTTTGTAAATTTGG + Intergenic
1053045531 9:34913298-34913320 ATTTATAACTTTACTAAATTTGG - Intergenic
1053491901 9:38513538-38513560 GTATATGTCCTTCCTAAAATTGG + Intergenic
1055290379 9:74776932-74776954 GTGTTTTTATTTGCTAAATTTGG - Intronic
1055604522 9:77954696-77954718 GCTTATGTCTTTAATAAATGAGG - Intronic
1056223790 9:84475531-84475553 ATGTAAGGCTTTACTACATTAGG - Intergenic
1056563507 9:87753736-87753758 GTGTGTGTCTTTAGTAGAATTGG + Intergenic
1057023893 9:91721544-91721566 GTGTATTTCCATACTAAGTTTGG - Intronic
1057672199 9:97102758-97102780 GTATATGTCCTTCCTAAAATTGG + Intergenic
1060139059 9:121189629-121189651 CTGTATGACTTTATTTAATTTGG - Intronic
1060760389 9:126242542-126242564 GTGTATGTATTTAAGAAAATTGG - Intergenic
1060882366 9:127126399-127126421 CTATATGTTTTTACTAAATTTGG + Intronic
1062747545 9:138223999-138224021 GTTTGTTTCTATACTAAATTAGG + Intergenic
1203656714 Un_KI270753v1:5008-5030 GTGTATTTTTATGCTAAATTTGG + Intergenic
1186858092 X:13644926-13644948 GTGTATATCTTTAATCAATTTGG + Intergenic
1187487462 X:19718125-19718147 GTGTGTGTATTTATAAAATTGGG - Intronic
1187622038 X:21067417-21067439 GTGTTTGTCTTTAATACATTTGG + Intergenic
1187988260 X:24838957-24838979 ATGTATGTGTTGACTAAGTTTGG + Intronic
1189108885 X:38266380-38266402 TTATATTTCTTTTCTAAATTTGG - Intronic
1189534268 X:41921463-41921485 CTGTATGTTTTTATTAAATGTGG + Intronic
1189956711 X:46283131-46283153 GTGTATGTCTCTGGTAAATGTGG - Intergenic
1191697907 X:64008079-64008101 ATGTATGTGTTTACAAAATAAGG + Intergenic
1193546752 X:82840740-82840762 GAGTTTGTCTTTAATAAAATTGG + Intergenic
1194242880 X:91473450-91473472 GTGTAAGTCTTTAATCTATTTGG - Intergenic
1194428422 X:93769538-93769560 TTTTATGTCTTTACTAACTCAGG + Intergenic
1195554673 X:106209014-106209036 GTGTGTGTGTGTATTAAATTTGG - Intergenic
1196881583 X:120203384-120203406 GTAAATGTGTTTACTAAAATTGG + Intergenic
1197047209 X:122011964-122011986 GTTTATGTATTTACTATATTTGG + Intergenic
1197060649 X:122176290-122176312 CTGTATTTCATTACTGAATTGGG + Intergenic
1197077380 X:122368675-122368697 GTGTGTGTCTTCACTAACTTTGG - Intergenic
1198431047 X:136566433-136566455 GTGTATGTCTTTACTGTTTGTGG - Intergenic
1199433954 X:147792117-147792139 GTTTACCTCTTTACTTAATTAGG + Intergenic
1201793079 Y:17863853-17863875 GTGTATCCCTTAATTAAATTAGG - Intergenic
1201808475 Y:18042133-18042155 GTGTATCCCTTAATTAAATTAGG + Intergenic